G163709


Basic Information

Item Value
gene id G163709
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053127.1
NCBI id CM020924.1
chromosome length 37730433
location 6407112 ~ 6407385 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU221887
cccacatttctaagatttttcttaaaattaggccctatgttcccacatatctaagatttttcttaaaattaggccctatgttcccacatttctaggacattttcaaaattaggtcttgtgttcctacatttcccttcaatttaagccctatcctcccgcaacattttttagggttatggttagggggataaaatctgatacaaatttatgaaaaaggaaatgtgggaacatagggcctaattttggaaaaaaatcttagaaatgtgggaactgt

Function

GO:

id name namespace
GO:0008152 metabolic process biological_process
GO:0009063 cellular amino acid catabolic process biological_process
GO:0009072 aromatic amino acid family metabolic process biological_process
GO:0009074 aromatic amino acid family catabolic process biological_process
GO:1901361 organic cyclic compound catabolic process biological_process
GO:0046395 carboxylic acid catabolic process biological_process
GO:0044282 small molecule catabolic process biological_process
GO:0006520 cellular amino acid metabolic process biological_process
GO:0016054 organic acid catabolic process biological_process
GO:0044421 obsolete extracellular region part cellular_component
GO:0005615 extracellular space cellular_component

KEGG:

id description
ko00130 Ubiquinone and other terpenoid-quinone biosynthesis
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU221887 True 274 lncRNA 0.35 1 6407112 6407385

Neighbor

gene id symbol gene type direction distance location
LOC120575570 ddc,LOC102780833 coding downstream 10785 6381059 ~ 6396327 (-)
gemin5 LOC102786240 coding downstream 43320 6328847 ~ 6363792 (-)
LOC120544211 NA coding downstream 116788 6286906 ~ 6290324 (-)
LOC120575643 LOC103353475 coding downstream 225151 6072218 ~ 6181961 (-)
LOC120575636 LOC100711410,LOC102305690,LOC102207837,LOC103358844,LOC106960860,LOC102785365 coding downstream 592970 5658407 ~ 5814142 (-)
rars1 rars coding upstream 883211 7290596 ~ 7321787 (-)
nop16 NA coding upstream 1051379 7458764 ~ 7471087 (-)
dbn1 dbn1 coding upstream 1219315 7626700 ~ 7782793 (-)
zgc:77151 NA coding upstream 1394832 7802217 ~ 7846803 (-)
LOC120543650 NA coding upstream 1500035 7907420 ~ 7948944 (-)
G163707 mrpl22,LOC102778570 non-coding downstream 36886 6369164 ~ 6370226 (-)
G163694 NA non-coding downstream 105135 6301684 ~ 6301977 (-)
G163688 NA non-coding downstream 116254 6283369 ~ 6290858 (-)
G163689 NA non-coding downstream 151460 6255384 ~ 6255652 (-)
G163643 NA non-coding downstream 243837 6162584 ~ 6163275 (-)
G163712 NA non-coding upstream 143852 6551237 ~ 6556460 (-)
G163715 NA non-coding upstream 239851 6647236 ~ 6647570 (-)
G163716 NA non-coding upstream 246000 6653385 ~ 6718138 (-)
G163721 NA non-coding upstream 380133 6787518 ~ 6787846 (-)
G163722 NA non-coding upstream 413984 6821369 ~ 6821573 (-)
LOC120544555 siah2,LOC101471392,LOC102786130 other downstream 1585240 4281773 ~ 4821872 (-)
G163315 NA other downstream 1586613 4334843 ~ 4820499 (-)
LOC120544563 NA other downstream 1656682 4735214 ~ 4750430 (-)
LOC120544552 LOC104935312,LOC100692486,LOC101485649,LOC106922321,LOC102232317,LOC102292363 other downstream 1712496 4606736 ~ 4694616 (-)
LOC120544568 LOC104932967,LOC104935308 other downstream 1913761 4491005 ~ 4493351 (-)
G163767 NA other upstream 849753 7257138 ~ 7286265 (-)
wwc1 wwc1 other upstream 923529 7330914 ~ 7398125 (-)
LOC120543652 LOC101463747,LOC100690676,LOC102213522,LOC102314573,LOC102780849 other upstream 1454068 7861453 ~ 7887088 (-)
G164022 kctd7,LOC102776841 other upstream 1939443 8346828 ~ 8352505 (-)
rabgef1 rabgef1,LOC102778478 other upstream 1961110 8368495 ~ 8380575 (-)

Expression


Co-expression Network