G174403 (unc13b,LOC102798935)


Basic Information

Item Value
gene id G174403
gene name unc13b,LOC102798935
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053128.1
NCBI id CM020925.1
chromosome length 37416781
location 12254818 ~ 12255275 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU236085
CTTGCCCACCTGGACAGTGACATATGGATCGCTGGATCCTGTCTTGTCCTTTGCCTGAAGTCCTTGGGCACAAACGACTGTGATGGTGATCTTGGCCGACCACTTTGAGGTGCCGTCGAGTACACTCTGCTTGATGGTCTTCATCTGCTGCGCGTGGATGGCTTTGCTGATGATAAACACTTCCCTGATAAGTTCAAAGATTTCTGGTTTGTTCCTTTCCCTGATCTTCATTCTGTCCTTCATGGCCATGATAATGTTCTGGGTCCGGTCTTCAGCTCCATGCTTAGAGCTCTTCTCTGCAGCAC

Function

symbol description
unc13b Enables GTP-dependent protein binding activity. Involved in several processes, including acrosomal vesicle exocytosis; cellular response to glucose stimulus; and positive regulation of protein secretion. Located in Golgi apparatus; cytosol; and membrane.

NR:

description
PREDICTED: protein unc-13 homolog B-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU236085 True 305 lncRNA 0.50 2 12254818 12255275

Neighbor

gene id symbol gene type direction distance location
LOC120546050 stoml2 coding downstream 70335 12175383 ~ 12184483 (-)
pigo pigo coding downstream 81434 12162293 ~ 12173384 (-)
phf24 phf24 coding downstream 140753 12077578 ~ 12114065 (-)
prkab1a prkab1,LOC103357303 coding downstream 186399 12057731 ~ 12068419 (-)
LOC120544995 LOC103357302,LOC104927697 coding downstream 198206 12054684 ~ 12056612 (-)
stbd1 NA coding upstream 56961 12312236 ~ 12318795 (-)
musk musk coding upstream 167559 12422834 ~ 12467165 (-)
si:busm1-57f23.1 NA coding upstream 234976 12490251 ~ 12497952 (-)
galt galt,LOC102780609 coding upstream 1099913 13355188 ~ 13386974 (-)
hdhd2 hdhd2 coding upstream 1176334 13431609 ~ 13439708 (-)
G174341 NA non-coding downstream 488358 11766230 ~ 11766460 (-)
G174335 NA non-coding downstream 508398 11746071 ~ 11746420 (-)
G174327 NA non-coding downstream 593956 11660525 ~ 11660862 (-)
G174325 NA non-coding downstream 594994 11659436 ~ 11659824 (-)
G174324 NA non-coding downstream 633158 11621447 ~ 11621660 (-)
G174430 NA non-coding upstream 32139 12287414 ~ 12342288 (-)
G174443 lpar1 non-coding upstream 154049 12409324 ~ 12416934 (-)
G174481 NA non-coding upstream 310427 12565702 ~ 12569571 (-)
G174482 NA non-coding upstream 371932 12627207 ~ 12627427 (-)
G174500 NA non-coding upstream 724551 12979826 ~ 12980285 (-)
LOC120545042 NA other downstream 1090324 11153767 ~ 11164494 (-)
adra1ab LOC104947653,LOC100705829 other downstream 1859074 10378956 ~ 10395744 (-)
gtf3c4 gtf3c4,LOC102793669 other downstream 2146529 10097251 ~ 10108289 (-)
grin1a grin1a,LOC107600932,LOC103389281,LOC105024190,LOC106513393,LOC100534577,LOC101475684,LOC104936329,LOC102201489,LOC102777117,LOC102302700 other downstream 2351811 9861001 ~ 9903007 (-)
G174120 NA other downstream 2411319 9842812 ~ 9843499 (-)
G174439 NA other upstream 101653 12356928 ~ 12357890 (-)
G174442 lpar1 other upstream 135280 12390555 ~ 12391484 (-)
tmem267 tmem267 other upstream 375950 12631225 ~ 12637494 (-)
cntfr cntfr,LOC108232720,LOC103473535 other upstream 391011 12646286 ~ 12918560 (-)
ier3ip1 ier3ip1,LOC106633120,LOC102779563,LOC104954869 other upstream 1186005 13441280 ~ 13444079 (-)

Expression


Co-expression Network