G176281 (LOC103390185)



Basic Information


Item Value
gene id G176281
gene name LOC103390185
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053128.1
NCBI id CM020925.1
chromosome length 37416781
location 19800983 ~ 19801199 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU238589
TTGATATCCTCCTGCCTGGGACTGGCCATGCCCTCCTCAATGTCCATCCGGTATTCAGTAAACTGGGTGGAGGCTAAAGGCAGCAGGTGGTCAGCCGCTCCGCTGGGCGCAGGGGGCTCTTGGCTCGGGGTGTCACGATACGTCATGATGGGAGAGAAGGCTGGGTGCTGCTCTAAAGAAGGTGGGGTGGGAAACATCCTCTGGAGGTCTGCTACTG

Function


NR:

description
PREDICTED: mediator of RNA polymerase II transcription subunit 13-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU238589 True 217 lncRNA 0.59 1 19800983 19801199

Neighbor


gene id symbol gene type direction distance location
ddx54 NA coding upstream 275659 19516810 ~ 19525324 (+)
trnac-gca_32 NA coding upstream 283677 19517235 ~ 19517306 (+)
abl1 abl1 coding upstream 314877 19449563 ~ 19486106 (+)
exosc2 exosc2 coding upstream 353384 19441576 ~ 19447599 (+)
mlana mlana coding upstream 478744 19318972 ~ 19322239 (+)
lman2la lman2l,LOC108231067 coding downstream 92917 19894116 ~ 19900260 (+)
pax8 pax8,LOC102780591 coding downstream 128372 19929571 ~ 19943843 (+)
LOC120545547 LOC103368295 coding downstream 162572 19963771 ~ 19970112 (+)
bspry bspry,LOC100703027,LOC102783296 coding downstream 219758 20020957 ~ 20028430 (+)
traf2b traf2 coding downstream 236665 20037864 ~ 20050223 (+)
G176243 NA non-coding upstream 102913 19697844 ~ 19698070 (+)
G176240 NA non-coding upstream 106645 19694106 ~ 19694338 (+)
LOC120545999 NA non-coding upstream 139928 19609671 ~ 19661055 (+)
LOC120546000 NA non-coding upstream 207271 19590742 ~ 19593712 (+)
G176226 LOC103367784 non-coding upstream 233814 19566939 ~ 19567169 (+)
G176282 med13l,LOC103390185 non-coding downstream 1041 19802240 ~ 19802531 (+)
G176283 NA non-coding downstream 1347 19802546 ~ 19803596 (+)
G176284 NA non-coding downstream 4000 19805199 ~ 19805615 (+)
G176286 med13l non-coding downstream 48491 19849690 ~ 19849905 (+)
G176287 NA non-coding downstream 66619 19867818 ~ 19869547 (+)
LOC120545529 ermp1,LOC102800265 other upstream 398604 19380250 ~ 19402379 (+)
srsf9 srsf9,LOC104958899,LOC100707309 other upstream 1077198 18676021 ~ 18723785 (+)
LOC120545610 NA other upstream 1143364 18656524 ~ 18657619 (+)
cabp7b cabp7,LOC104925332 other upstream 1149914 18635026 ~ 18651069 (+)
myo1hb LOC103374943,LOC101465300,LOC102786650 other upstream 1252842 18536631 ~ 18548141 (+)
LOC120545241 LOC105930800,LOC102780299,LOC103149678,LOC107095870,LOC100701678 other downstream 110637 19911836 ~ 19914680 (+)
pappaa pappa other downstream 714148 20515347 ~ 20620786 (+)
G176526 NA other downstream 1145485 20946684 ~ 20947055 (+)
G176753 NA other downstream 2477681 22278880 ~ 22282163 (+)
LOC120545252 NA other downstream 2695214 22496413 ~ 22524405 (+)

Expression



Co-expression Network