G176905 (hcn1,LOC108278484,LOC106958946)


Basic Information

Item Value
gene id G176905
gene name hcn1,LOC108278484,LOC106958946
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053128.1
NCBI id CM020925.1
chromosome length 37416781
location 22705726 ~ 22706124 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU239426
TGTATCTGATGAGTCGGGACAGTCTCAACAGACGCAGAAGACTGAGGATCTTCGTGAAGCGGACGATTCGCAGGGCACGTGCCGTTTTATATACCTCAGAGTCAAAGCCTTTCTCCACTATTAAAAAGATATAATCCACTGGAATGGAGGAGAGGAAGTCCACAACGAACCAGCTCTTCAGGTAATTCATCTTGATGACTTTGGGGTCAAGGATGATCTCAGAGCTCTCCTCGTTGACGATCCCCGTCCTGAAGTTCATGACCAGGTCCACCAGGAAGATGGTGTCCGAGGCCACATTGAAGACCAGCCAGGTGGTGGTAGTCTGCTCTGAGAAGAATGTTATTCCCACAGGAATGATGATTAGATTCCCCATCATCATGATGAGCATTATCAAGTCCC

Function

symbol description
hcn1 Predicted to enable cAMP binding activity; sodium channel activity; and voltage-gated potassium channel activity. Acts upstream of or within neuron-neuron synaptic transmission and posterior lateral line neuromast hair cell development. Predicted to be located in membrane. Predicted to be integral component of plasma membrane. Is expressed in neuromast hair cell.

NR:

description
PREDICTED: potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU239426 True 399 lncRNA 0.48 1 22705726 22706124

Neighbor

gene id symbol gene type direction distance location
nedd4l nedd4l,LOC107584553 coding upstream 234178 22423582 ~ 22471548 (+)
dnajc21 dnajc21 coding upstream 321104 22377113 ~ 22384622 (+)
rad1 rad1 coding upstream 332935 22369167 ~ 22372791 (+)
ctif ctif coding upstream 477842 22168378 ~ 22227884 (+)
shc3 shc3,LOC102305817 coding upstream 618745 22056040 ~ 22086981 (+)
esm1 esm1,LOC102788147 coding downstream 105994 22812118 ~ 22814146 (+)
arhgap24 arhgap24,LOC102789489 coding downstream 118176 22824300 ~ 22892523 (+)
ptpn13 ptpn13 coding downstream 230580 22936704 ~ 22984920 (+)
LOC120545187 NA coding downstream 279080 22985204 ~ 22989316 (+)
sdad1 sdad1 coding downstream 284030 22990154 ~ 22996841 (+)
G176904 hcn1,LOC104948050,LOC106560798,LOC107749006,LOC107662227,LOC103390262 non-coding upstream 43908 22661584 ~ 22661818 (+)
G176903 NA non-coding upstream 50901 22654610 ~ 22654825 (+)
G176902 NA non-coding upstream 55147 22650298 ~ 22650579 (+)
G176901 NA non-coding upstream 55886 22649385 ~ 22649840 (+)
G176900 NA non-coding upstream 56408 22649081 ~ 22649318 (+)
G176906 LOC107085810,LOC102226223,LOC103473886,LOC106958946,LOC106918003,LOC105921164 non-coding downstream 7782 22713906 ~ 22714497 (+)
G176908 NA non-coding downstream 40984 22747108 ~ 22747326 (+)
G176974 NA non-coding downstream 187032 22893156 ~ 22933645 (+)
G177039 scarb2,LOC104955650,LOC107395254 non-coding downstream 398518 23104642 ~ 23116716 (+)
G177043 NA non-coding downstream 428525 23134649 ~ 23134887 (+)
G176870 cplx4 other upstream 168389 22531908 ~ 22537337 (+)
LOC120545252 NA other upstream 181321 22496413 ~ 22524405 (+)
G176753 NA other upstream 423563 22278880 ~ 22282163 (+)
G176526 NA other upstream 1758671 20946684 ~ 20947055 (+)
pappaa pappa other upstream 2084940 20515347 ~ 20620786 (+)
klhl8 klhl8 other downstream 292129 22998253 ~ 23008834 (+)
G177094 NA other downstream 476549 23182673 ~ 23184262 (+)
hnrpkl LOC103364541,LOC100706673,LOC103155138,LOC103473466 other downstream 734859 23440983 ~ 23458605 (+)
rpl37 rpl37 other downstream 1017354 23723478 ~ 23727242 (+)
LOC120546142 NA other downstream 1018042 23724166 ~ 23724245 (+)

Expression


Co-expression Network