G181599



Basic Information


Item Value
gene id G181599
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053129.1
NCBI id CM020926.1
chromosome length 36987114
location 1683039 ~ 1683419 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU246161
ttcaattcaattcaattttatttatagtatcaaatcataacataagttatctcgagacactttacagatagagtaggtctagaccacactctataatttacaaagccccaacaattccaacaattccagtaattccctcaagagcaagcagtgcgacagtggcgaggaaaaactccctcttgggaagaaacctcggacagacccaggctcttggtgggcggtgtctgacgagccggttgggggtgtgatgaacagtggcgatagtagtcacattaataatggaacagtgactggatgtagcgggaagctgcagggttcagcaggacgcagcatgacattgcagggcatcgctgagctcagcagggagtgcagcaggacccc

Function


GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA


RNA id representative length rna type GC content exon number start site end site
TU246161 True 381 lncRNA 0.48 1 1683039 1683419

Neighbor


gene id symbol gene type direction distance location
lama4 lama4 coding downstream 22481 1604943 ~ 1660558 (-)
tube1 tube1 coding downstream 105576 1540093 ~ 1577463 (-)
si:dkey-119m7.4 LOC100698612,LOC104922931,LOC102792392,LOC102205754,LOC102310158,LOC101479579 coding downstream 128856 1522277 ~ 1554183 (-)
fynb fyn,LOC103458010,LOC106529781 coding downstream 167016 1399499 ~ 1516023 (-)
LOC120547163 LOC104959543,LOC108248898,LOC106958584,LOC103140751,LOC106529783,LOC106903326,LOC104922943 coding downstream 288924 1391056 ~ 1394115 (-)
LOC120547226 hs3st5,LOC102794156 coding upstream 352246 2035665 ~ 2163743 (-)
LOC120546265 NA coding upstream 639245 2322664 ~ 2325278 (-)
frk frk,LOC102794634 coding upstream 676014 2359433 ~ 2384085 (-)
col10a1b col10a1,LOC104966941,LOC107384801 coding upstream 717315 2400734 ~ 2407155 (-)
ufl1 ufl1,LOC104942535 coding upstream 907043 2590462 ~ 2613535 (-)
G181597 LOC104947167 non-coding downstream 623 1682041 ~ 1682416 (-)
G181564 NA non-coding downstream 78214 1590281 ~ 1604825 (-)
G181584 NA non-coding downstream 153322 1529245 ~ 1529717 (-)
G181576 NA non-coding downstream 295197 1387574 ~ 1387842 (-)
G181575 NA non-coding downstream 295724 1387068 ~ 1387315 (-)
G181610 NA non-coding upstream 112837 1796256 ~ 1796671 (-)
G181612 NA non-coding upstream 120813 1804232 ~ 1804511 (-)
G181620 NA non-coding upstream 157969 1841388 ~ 1841599 (-)
G181622 NA non-coding upstream 203642 1887061 ~ 1887628 (-)
G181633 NA non-coding upstream 262064 1945483 ~ 1949524 (-)
G181297 NA other downstream 1043526 638810 ~ 639513 (-)
G181206 NA other downstream 1603729 57976 ~ 79310 (-)
G181196 NA other downstream 1634286 47081 ~ 48753 (-)
G181860 NA other upstream 1692346 3375765 ~ 3376108 (-)
G181919 bach2 other upstream 1925428 3608847 ~ 3610329 (-)
srp9 srp9 other upstream 2208218 3891637 ~ 3893175 (-)
G182061 NA other upstream 2223198 3906617 ~ 3912279 (-)
G182059 NA other upstream 2225128 3908547 ~ 3914015 (-)

Expression



Co-expression Network