G182367


Basic Information

Item Value
gene id G182367
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053129.1
NCBI id CM020926.1
chromosome length 36987114
location 5226393 ~ 5226670 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU247092
tatagtgcttttctagtcttaacgactactcaaagcgctttaacatagtacaggaaccattcacctttcacacacattcatacactgtggccgaggctgccgtacaaggtgccacctgctcatcagataaactttcacacacatttacactccgatggcagcatcgggggcaactcggggttcagtgtcttgcccaaggacacttcggcatggaactgcagggccagggattgaaccaccaaccttctgattggcaggcgacctctctaccacttagc

Function

GO: NA

KEGG:

id description
ko00140 Steroid hormone biosynthesis
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA

RNA id representative length rna type GC content exon number start site end site
TU247092 True 278 lncRNA 0.50 1 5226393 5226670

Neighbor

gene id symbol gene type direction distance location
LOC120546193 NA coding downstream 102612 5115179 ~ 5123781 (-)
LOC120546227 htr1e coding downstream 312202 4871142 ~ 4914191 (-)
znf292b NA coding downstream 373310 4819147 ~ 4853083 (-)
cenpe cenpe coding downstream 442075 4743144 ~ 4784318 (-)
rad51 rad51 coding downstream 484748 4731388 ~ 4741645 (-)
LOC120547277 NA coding upstream 21275 5247945 ~ 5253700 (-)
LOC120547345 NA coding upstream 32795 5259465 ~ 5279720 (-)
lrfn2b LOC103354004,LOC104943823 coding upstream 162483 5389153 ~ 5588237 (-)
gopc gopc coding upstream 759767 5986437 ~ 6009440 (-)
LOC120546792 LOC104959018 coding upstream 843876 6070546 ~ 6073220 (-)
G182358 NA non-coding downstream 80673 5145512 ~ 5145720 (-)
G182356 NA non-coding downstream 100372 5125813 ~ 5126021 (-)
LOC120547022 NA non-coding downstream 112672 5112241 ~ 5113721 (-)
G182348 NA non-coding downstream 125941 5100188 ~ 5100452 (-)
G182329 NA non-coding downstream 250457 4975564 ~ 4975936 (-)
G182368 NA non-coding upstream 9163 5235833 ~ 5236208 (-)
G182413 NA non-coding upstream 160137 5386807 ~ 5388183 (-)
G182441 NA non-coding upstream 441047 5667717 ~ 5667916 (-)
G182443 NA non-coding upstream 469786 5696456 ~ 5696803 (-)
G182472 NA non-coding upstream 550582 5777252 ~ 5777743 (-)
smim8 smim8 other downstream 422901 4745773 ~ 4803492 (-)
G182121 NA other downstream 1060397 4163358 ~ 4165996 (-)
trnav-aac_21 NA other downstream 1070561 4155760 ~ 4155832 (-)
trnav-aac_20 NA other downstream 1077415 4148907 ~ 4148978 (-)
G182102 NA other downstream 1125913 4100010 ~ 4100480 (-)
zgc:112001 LOC103354005,LOC100690140,LOC102211542,LOC102799045,LOC102300982 other upstream 84836 5311506 ~ 5313715 (-)
G182474 NA other upstream 563619 5790289 ~ 5792938 (-)
G182502 NA other upstream 684642 5911312 ~ 5911909 (-)
cgrrf1 NA other upstream 1006072 6232742 ~ 6269143 (-)
G182764 NA other upstream 1473821 6700491 ~ 6701117 (-)

Expression


Co-expression Network