G183298 (emilin1,LOC103398511,LOC103372345)


Basic Information

Item Value
gene id G183298
gene name emilin1,LOC103398511,LOC103372345
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053129.1
NCBI id CM020926.1
chromosome length 36987114
location 9709053 ~ 9715339 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU248268
CTCCAGCTGTCTGATCTTCTCAGAGTCACCTTCTCCTCCCTGTCTGCCGCCTGGGTTGTAGCCCGTCGGCGTGACGCTGGGTCGCCCTCCATTGACCTGGGTGTTGGTTGTTCCCTTTGGCCCATCGTGGCAGTCTTCCCCAGAGTAACCATGGCAACATTTCCACTCCATTTCTGTCACCATCTTGTAAGCTACCTTATACCGTGGCCTCCTGAATGTCCGGTAGGCAACTCGAGGACACTGGCCCCAGGTACAGCGTTGATAGTCTGGTTTGATGTACG

Function

symbol description
emilin1 Enables identical protein binding activity and integrin binding activity involved in cell-matrix adhesion. Involved in cell migration and cell-matrix adhesion. Located in collagen-containing extracellular matrix and extracellular space. Part of EMILIN complex and integrin alpha4-beta1 complex.

NR:

description
PREDICTED: EMILIN-1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU248268 True 281 lncRNA 0.56 3 9709053 9715339

Neighbor

gene id symbol gene type direction distance location
stmn4 stmn4 coding downstream 86342 9603488 ~ 9622711 (-)
paqr8 paqr8 coding downstream 152124 9550004 ~ 9556929 (-)
znf395b znf395 coding downstream 181625 9505432 ~ 9527428 (-)
si:ch211-63o20.7 LOC103362993,LOC101481409 coding downstream 238536 9460778 ~ 9470517 (-)
LOC120547212 NA coding downstream 306288 9330484 ~ 9402765 (-)
LOC120546991 NA coding upstream 138401 9853740 ~ 9855384 (-)
LOC120547068 NA coding upstream 229526 9944865 ~ 9945741 (-)
LOC120547244 NA coding upstream 420661 10136000 ~ 10137776 (-)
cnstb LOC103373900 coding upstream 432736 10148075 ~ 10173978 (-)
kif26bb NA coding upstream 462970 10178309 ~ 10208325 (-)
G183296 NA non-coding downstream 21934 9686722 ~ 9687119 (-)
G183263 NA non-coding downstream 165827 9532546 ~ 9543226 (-)
G183258 NA non-coding downstream 203681 9501912 ~ 9505372 (-)
G183256 NA non-coding downstream 215649 9493179 ~ 9493404 (-)
G183213 NA non-coding downstream 380530 9327400 ~ 9328523 (-)
G183299 LOC103398511 non-coding upstream 1251 9716590 ~ 9718205 (-)
G183317 snap25,snap25a,LOC107719097,LOC102796069,LOC107698362,LOC107599071 non-coding upstream 114537 9829876 ~ 9846858 (-)
LOC120546255 NA non-coding upstream 219848 9935187 ~ 9969773 (-)
G183382 NA non-coding upstream 329842 10045181 ~ 10045495 (-)
G183383 NA non-coding upstream 332618 10047957 ~ 10048232 (-)
G183176 NA other downstream 575581 9129573 ~ 9133472 (-)
LOC120546609 LOC104943934,LOC103373611,LOC100711814,LOC102780583,LOC101487794,LOC102295678 other downstream 684488 9020960 ~ 9024565 (-)
LOC120546397 NA other downstream 921835 8781328 ~ 8787218 (-)
opn5 opn5,LOC102784832,LOC100710023,LOC102313452,LOC104967814,LOC106933152,LOC108249775 other downstream 1582389 8049458 ~ 8126664 (-)
G182977 NA other downstream 1684009 8024715 ~ 8025044 (-)
LOC120546281 LOC107372644,LOC107099224,LOC106591698 other upstream 384139 10099478 ~ 10101061 (-)
LOC120546776 NA other upstream 739905 10455244 ~ 10610625 (-)
G183528 NA other upstream 805378 10520717 ~ 10521410 (-)
G183650 NA other upstream 1658769 11374108 ~ 11374615 (-)
ost4 NA other upstream 3191963 12907302 ~ 12908747 (-)

Expression


Co-expression Network