G183492 (hnrnpu)


Basic Information

Item Value
gene id G183492
gene name hnrnpu
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053129.1
NCBI id CM020926.1
chromosome length 36987114
location 10216351 ~ 10217126 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU248497
GATCCAGAATGTAGTTTCTCTTCTTGCGTGCAGCAATTTCAATAAACTTTCCCAGGAAAAGTGGTGCTCTCTGGGAAATGGCGGTCAGTTTCGTAATGTCCTTGGACTGTCGTTTCAGGCTGTTTATCATCATCTTGTCCACGATGGTGTCACTGCCCAGGATGTAGTATTTCCCAGGGTTCTCCTGGACATGGTTCTTCACCCACGTAGTCTTCCCTGAGCCTGGAAGGCCGACCATCACTATGATCTCGCAGTCAGCCTTGGTCTGTGGGCCCTTGAGCCCACGGACTCTGTCATCCAAAGGTATCTGCTGCAGGAAGGTGTAGCCCTGAGGCTGAGGGAAGTACGGAGTCTCCATCTGGCCAAAGTTGAACTCCACGGCGCAATTGTGGCAGATGACGTGTGGGAAAAGGGCCTGGCCGTTCAGAGTCTCCTTGTTCATCTGGAAGGCGACAGCCGGCTCGGCGCCATTCTTGGAGAAGGACAACACCACATCCTCGCCCTCAAAGTCCTAAGCAAAGAAAGCGAGACGCAAA

Function

symbol description
hnrnpu Enables several functions, including ATP binding activity; basal RNA polymerase II transcription machinery binding activity; and nucleic acid binding activity. Involved in several processes, including protein localization to organelle; regulation of cell cycle process; and regulation of nucleobase-containing compound metabolic process. Located in several cellular components, including chromosome; microtubule cytoskeleton; and nuclear lumen. Part of CRD-mediated mRNA stability complex; catalytic step 2 spliceosome; and telomerase holoenzyme complex. Colocalizes with RNA polymerase II transcription regulator complex. Implicated in developmental and epileptic encephalopathy 54. Biomarker of colorectal cancer.

NR:

description
PREDICTED: heterogeneous nuclear ribonucleoprotein U isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU248497 True 536 lncRNA 0.53 3 10216351 10217126

Neighbor

gene id symbol gene type direction distance location
kif26bb NA coding downstream 8026 10178309 ~ 10208325 (-)
cnstb LOC103373900 coding downstream 42373 10148075 ~ 10173978 (-)
LOC120547244 NA coding downstream 78575 10136000 ~ 10137776 (-)
LOC120547068 NA coding downstream 270610 9944865 ~ 9945741 (-)
LOC120546991 NA coding downstream 360967 9853740 ~ 9855384 (-)
lft1 LOC104927083,LOC104968260,LOC100695903,LOC101475792,LOC102299013 coding upstream 9690 10226816 ~ 10229005 (-)
fzd3a fzd3 coding upstream 129874 10347000 ~ 10379127 (-)
fam49a fam49a coding upstream 181676 10398802 ~ 10449410 (-)
sf3b6 sf3b6,pm14,SF3B6 coding upstream 444991 10662117 ~ 10666300 (-)
pla2g7 pla2g7,LOC102800283 coding upstream 476713 10693839 ~ 10708837 (-)
G183457 NA non-coding downstream 38782 10176900 ~ 10177569 (-)
G183458 NA non-coding downstream 40996 10174736 ~ 10175355 (-)
LOC120547073 NA non-coding downstream 150065 10064593 ~ 10066286 (-)
G183383 NA non-coding downstream 168119 10047957 ~ 10048232 (-)
G183382 NA non-coding downstream 170856 10045181 ~ 10045495 (-)
G183497 NA non-coding upstream 3792 10220918 ~ 10233568 (-)
G183530 NA non-coding upstream 340361 10557487 ~ 10558119 (-)
G183531 NA non-coding upstream 348790 10565916 ~ 10566164 (-)
G183534 NA non-coding upstream 373954 10591080 ~ 10591338 (-)
G183594 NA non-coding upstream 537870 10754996 ~ 10780282 (-)
LOC120546281 LOC107372644,LOC107099224,LOC106591698 other downstream 115290 10099478 ~ 10101061 (-)
G183176 NA other downstream 1082879 9129573 ~ 9133472 (-)
LOC120546609 LOC104943934,LOC103373611,LOC100711814,LOC102780583,LOC101487794,LOC102295678 other downstream 1191786 9020960 ~ 9024565 (-)
LOC120546397 NA other downstream 1429133 8781328 ~ 8787218 (-)
opn5 opn5,LOC102784832,LOC100710023,LOC102313452,LOC104967814,LOC106933152,LOC108249775 other downstream 2089687 8049458 ~ 8126664 (-)
LOC120546776 NA other upstream 238118 10455244 ~ 10610625 (-)
G183528 NA other upstream 303591 10520717 ~ 10521410 (-)
G183650 NA other upstream 1156982 11374108 ~ 11374615 (-)
ost4 NA other upstream 2690176 12907302 ~ 12908747 (-)
LOC120547209 NA other upstream 2743372 12960498 ~ 13007868 (-)

Expression


Co-expression Network