G184662 (stx7)


Basic Information

Item Value
gene id G184662
gene name stx7
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053129.1
NCBI id CM020926.1
chromosome length 36987114
location 15734418 ~ 15735282 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU250055
CTGCATTCTCCACATTGGCTTCTATACTGTCTATCATGTCTCCCTGCTCATGGACCATCATCCCCAGGTCCTTGAAGATGTCATTGATATCGGTGATGTCCGACTCCAACTGCCTGATGGACGACTCTCTCTCCTGGATCAGCCTCAAGTCTTCTTCAGTGATGGCCTCAGTCTGAGCCTGCACCTGAGAATCACCAAGGAAATTAGGCACATTTCCAAAGCTGTCATCAG

Function

symbol description
stx7 Enables chloride channel inhibitor activity and syntaxin binding activity. Involved in several processes, including positive regulation of T cell mediated cytotoxicity; positive regulation of receptor localization to synapse; and regulation of protein localization to plasma membrane. Located in cytoplasmic vesicle; immunological synapse; and perinuclear region of cytoplasm.

NR:

description
PREDICTED: syntaxin-7

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU250055 True 231 lncRNA 0.49 4 15734418 15735282

Neighbor

gene id symbol gene type direction distance location
LOC120546258 NA coding downstream 11077 15720429 ~ 15723341 (-)
wdr21 dcaf4 coding downstream 39797 15688518 ~ 15694621 (-)
pigh pigh,LOC102778419 coding downstream 54166 15677870 ~ 15680252 (-)
vps18 vps18 coding downstream 74927 15653902 ~ 15659491 (-)
ino80 ino80 coding downstream 82123 15606068 ~ 15652295 (-)
chga NA coding upstream 42141 15777423 ~ 15785606 (-)
sel1l sel1l coding upstream 60489 15795771 ~ 15806849 (-)
arhgap18 arhgap18 coding upstream 72801 15808083 ~ 15830786 (-)
fkbp6 fkbp6 coding upstream 96497 15831779 ~ 15839516 (-)
tmem244 tmem244 coding upstream 105864 15841146 ~ 15919640 (-)
LOC120546341 NA non-coding downstream 33419 15696500 ~ 15700999 (-)
G184452 LOC103369942,LOC106518591 non-coding downstream 445533 15283249 ~ 15288885 (-)
G184420 NA non-coding downstream 560299 15173711 ~ 15174119 (-)
G184417 LOC101473650,LOC102776111,LOC103369946,LOC102310296 non-coding downstream 560778 15169136 ~ 15173640 (-)
G184404 LOC103369948,LOC101169258 non-coding downstream 595703 15132217 ~ 15138715 (-)
G184668 ctgf non-coding upstream 37404 15772686 ~ 15775486 (-)
G184696 NA non-coding upstream 277218 16012500 ~ 16015535 (-)
G184699 LOC107390449 non-coding upstream 289936 16025218 ~ 16033730 (-)
G184702 coq8a,LOC102220701,LOC103144166 non-coding upstream 302468 16037750 ~ 16042215 (-)
G184705 NA non-coding upstream 329389 16064671 ~ 16064914 (-)
rps29 NA other downstream 622939 15110240 ~ 15111479 (-)
LOC120547045 LOC103359896,LOC104919819,LOC100704859,LOC107378087,LOC104956714 other downstream 1066817 14657177 ~ 14667601 (-)
naa30 naa30,LOC102795089,LOC104960600 other downstream 1121472 14571380 ~ 14612946 (-)
G184299 LOC101066055,LOC100706360,LOC102203025 other downstream 1236048 14472201 ~ 14498370 (-)
mfsd2b mfsd2b other downstream 2243275 13473683 ~ 13491143 (-)
si:dkey-177p2.18 LOC102081001,LOC102302990,LOC107088471,LOC105937616,LOC105357244,LOC102210773,LOC101470269,LOC104966503 other upstream 53544 15788826 ~ 15795638 (-)
LOC120546224 NA other upstream 330572 16065854 ~ 16068309 (-)
LOC120546332 akap7 other upstream 411308 16146590 ~ 16188330 (-)
snap91b LOC101475403,LOC107094487,LOC107378032,LOC106520033,LOC108247682 other upstream 755368 16490650 ~ 16517874 (-)
gpatch2 gpatch2,LOC102785715 other upstream 1090370 16825652 ~ 16835983 (-)

Expression


Co-expression Network