G185591 (kcnk2)


Basic Information

Item Value
gene id G185591
gene name kcnk2
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053129.1
NCBI id CM020926.1
chromosome length 36987114
location 19024264 ~ 19024578 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU251369
TGCGGTGCACATGTGTTGAGTCAGCCTGGCAGAGGAACAACTATAAACACACTGATTCGAAACTGGGTGTCTGACATAAAAATGAAAGACGGCCGGTAAATCAGAAAGAAAATCAAGTGACCTTTTTCACCGGCGACAAAGTCTCCAAAGCCGATTGTGGTGAGGGTTATGACGACAAAATAGATGGACTCTAGCGTGCTCCAGCCCTCGATGTGCTTGAAGATGATGACTGGCAGAGCCACGAAGATGAGGCACCCGAACAGAATGAAGATCAGCGTGGAGATGACGCGGATCTTCGTCTGGCTGACTTTCCAC

Function

symbol description
kcnk2 Predicted to enable outward rectifier potassium channel activity; potassium channel inhibitor activity; and potassium ion leak channel activity. Predicted to be involved in potassium ion transmembrane transport and stabilization of membrane potential. Predicted to act upstream of or within G protein-coupled receptor signaling pathway; potassium ion transport; and regulation of membrane potential. Predicted to be located in endoplasmic reticulum and plasma membrane. Predicted to be part of voltage-gated potassium channel complex. Predicted to be integral component of plasma membrane.

NR:

description
PREDICTED: potassium channel subfamily K member 2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU251369 True 315 lncRNA 0.49 1 19024264 19024578

Neighbor

gene id symbol gene type direction distance location
prkg3 LOC104947339,LOC103364985,LOC100708987,LOC101479945 coding upstream 21234 18990946 ~ 19003030 (+)
LOC120546316 LOC104947340,LOC103364984,LOC107377588,LOC106510778 coding upstream 34490 18982177 ~ 18989774 (+)
ctsbb ctsb,LOC104947341 coding upstream 43086 18977830 ~ 18981178 (+)
fdft1 fdft1 coding upstream 46813 18966206 ~ 18977451 (+)
gata4 gata4,LOC102782453 coding upstream 65462 18948320 ~ 18958802 (+)
si:ch211-203k16.3 LOC102290548,LOC102780528,LOC100708179,LOC101478729,LOC102192128,LOC103369909 coding downstream 46091 19070669 ~ 19076482 (+)
moxd1l NA coding downstream 72481 19097059 ~ 19102420 (+)
rps6kc1 rps6kc1 coding downstream 78005 19102583 ~ 19126659 (+)
smyd2b smyd2,LOC103360985 coding downstream 235684 19260262 ~ 19269398 (+)
LOC120546239 NA coding downstream 303429 19328007 ~ 19333616 (+)
G185590 NA non-coding upstream 1234 19022696 ~ 19023030 (+)
G185589 NA non-coding upstream 4731 19014726 ~ 19019533 (+)
G185495 daam1,LOC108240128 non-coding upstream 203118 18819084 ~ 18821146 (+)
G185471 NA non-coding upstream 319030 18703965 ~ 18705234 (+)
LOC120546607 NA non-coding upstream 334231 18666640 ~ 18690033 (+)
G185592 kcnk2 non-coding downstream 18646 19043224 ~ 19043548 (+)
G185593 NA non-coding downstream 20836 19045414 ~ 19046107 (+)
G185599 snx9,LOC106928315,LOC103138599,LOC106957401 non-coding downstream 58118 19082696 ~ 19083784 (+)
G185656 NA non-coding downstream 253529 19278107 ~ 19279357 (+)
G185696 NA non-coding downstream 528696 19553274 ~ 19554235 (+)
LOC120547227 LOC104932566,LOC103364615 other upstream 312270 18705856 ~ 18711994 (+)
ylpm1 ylpm1 other upstream 389212 18598365 ~ 18635052 (+)
znf513a znf513,LOC102795572 other upstream 884004 18127131 ~ 18140260 (+)
fndc4a fndc4,LOC107589087,LOC107723530,LOC106923250 other upstream 969338 18020956 ~ 18054926 (+)
G185237 NA other upstream 1107016 17916853 ~ 17917248 (+)
LOC120546624 prox1 other downstream 179576 19204154 ~ 19237033 (+)
acbd3 acbd3,LOC102799892 other downstream 330038 19354616 ~ 19427489 (+)
si:dkey-206f10.1 LOC103360989,LOC103380838 other downstream 343142 19367720 ~ 19389223 (+)
nhsl1b nhsl1,LOC101470763 other downstream 405017 19429595 ~ 19541832 (+)
zgc:193593 NA other downstream 547995 19572573 ~ 19620783 (+)

Expression


Co-expression Network