G189114 (htr1e,htr1b,LOC103130375,LOC106909287,LOC103457078)


Basic Information

Item Value
gene id G189114
gene name htr1e,htr1b,LOC103130375,LOC106909287,LOC103457078
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053129.1
NCBI id CM020926.1
chromosome length 36987114
location 32965274 ~ 32965502 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU256261
GCAGCAGCGTGGGGATGTAGAACGCGCCGAACGTGGAGTAGATGGTGTAGAAAATGTGGTCCGTGTTCACGTTGCAGCTCGTCATCTCCTCCGCCTTCACCTGGCGCCAGAAGAACGGCGGCAGCGAGATGGAGATGGCGATCACCCAGGCGGTGGCGATCATCCCGGCGGCGCGCCCCATCGTGCGCTTCTTGGAGTACTCCACGGCGTCCGTGATGGCCCAGTAGCG

Function

symbol description
htr1b Predicted to enable G protein-coupled serotonin receptor activity; neurotransmitter receptor activity; and serotonin binding activity. Predicted to be involved in G protein-coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger; adenylate cyclase-inhibiting serotonin receptor signaling pathway; and chemical synaptic transmission. Predicted to act upstream of or within several processes, including G protein-coupled receptor signaling pathway; bone remodeling; and vasoconstriction. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Predicted to be active in dendrite. Predicted to be integral component of plasma membrane. Is expressed in central nervous system; pharynx; and retina. Human ortholog(s) of this gene implicated in attention deficit hyperactivity disorder and conduct disorder. Orthologous to human HTR1B (5-hydroxytryptamine receptor 1B).
htr1e Enables G protein-coupled serotonin receptor activity and serotonin binding activity. Involved in adenylate cyclase-inhibiting G protein-coupled receptor signaling pathway. Is integral component of plasma membrane.

NR:

description
PREDICTED: 5-hydroxytryptamine receptor 1B-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU256261 True 229 lncRNA 0.63 1 32965274 32965502

Neighbor

gene id symbol gene type direction distance location
senp6a NA coding upstream 395997 32535735 ~ 32569277 (+)
cd109 NA coding upstream 819364 32111590 ~ 32145910 (+)
crnkl1 crnkl1 coding upstream 859614 32093951 ~ 32105660 (+)
nkx2.4b nkx2-4,LOC103364681,LOC102215835,LOC102780891 coding upstream 1080472 31881465 ~ 31884802 (+)
nkx2.2b NA coding upstream 1095978 31866894 ~ 31869296 (+)
nt5e NA coding downstream 133867 33099369 ~ 33127591 (+)
bub1 NA coding downstream 235903 33201405 ~ 33228839 (+)
LOC120546516 NA coding downstream 265532 33231034 ~ 33238327 (+)
LOC120546153 LOC103369399 coding downstream 314409 33279911 ~ 33286940 (+)
LOC120546181 adgrg6 coding downstream 664298 33629800 ~ 33666253 (+)
G189034 NA non-coding upstream 204185 32758841 ~ 32761089 (+)
G189037 NA non-coding upstream 209321 32754590 ~ 32755953 (+)
G189035 NA non-coding upstream 314929 32649830 ~ 32650345 (+)
G189027 NA non-coding upstream 394639 32563850 ~ 32570635 (+)
G189029 NA non-coding upstream 398913 32565532 ~ 32566361 (+)
G189117 NA non-coding downstream 6508 32972010 ~ 32972221 (+)
G189125 NA non-coding downstream 77396 33042898 ~ 33043227 (+)
G189131 NA non-coding downstream 112605 33078107 ~ 33078410 (+)
G189134 NA non-coding downstream 127215 33092717 ~ 33093335 (+)
G189136 NA non-coding downstream 128347 33093849 ~ 33094280 (+)
myo6a myo6,LOC103369425 other upstream 198271 32576456 ~ 32767003 (+)
LOC120546196 LOC105017826 other upstream 1183208 31776963 ~ 31782066 (+)
LOC120546816 NA other upstream 1350752 31606054 ~ 31614522 (+)
hivep2a LOC103373864 other upstream 1655878 31169067 ~ 31309396 (+)
G188352 NA other upstream 2082828 30611681 ~ 30882446 (+)
mei4 NA other downstream 336 32965838 ~ 33041169 (+)
pex7 pex7,LOC102797744 other downstream 362590 33328092 ~ 33386989 (+)
LOC120546192 slc35d3,LOC102797457 other downstream 434299 33399801 ~ 33416086 (+)
G189269 NA other downstream 488494 33453996 ~ 33458768 (+)
G189309 NA other downstream 676118 33641620 ~ 33685556 (+)

Expression


Co-expression Network