Fish Transcriptome and Expression Database

trnal-uag_18

Item	Value
gene id	trnal-uag_18
gene name	NA
gene type	non-coding
species	eurasian perch (Perca fluviatilis)
category of species	economic fish

Item	Value
chromosome id	NC_053129.1
NCBI id	CM020926.1
chromosome length	36987114
location	216523 ~ 216605 (+)
genome version	GENO_Pfluv_1.0_2020_eurasian_perch_Genome

>unassigned_transcript_991
GGTAGTGTGGGCCGAGTGGTCTAAGGCGCTGGATTTAGGCTCTAGTCTCTCTGGAGGCGTGGGTTCAAATTCCACCACTGCCA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
unassigned_transcript_991	True	83	tRNA	0.57	1	216523	216605

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

gene id	symbol	gene type	direction	distance	location
trnav-aac_11	NA	coding	upstream	208911	7540 ~ 7612 (+)
gja1b	gja1,LOC104939046,LOC107094788	coding	downstream	41617	258222 ~ 265686 (+)
hsf2	NA	coding	downstream	293529	510134 ~ 529647 (+)
LOC120546301	NA	coding	downstream	432693	649298 ~ 650373 (+)
trnav-cac_9	NA	coding	downstream	606195	822800 ~ 822872 (+)
trnav-cac_10	NA	coding	downstream	607721	824326 ~ 824398 (+)
trnam-cau_52	NA	non-coding	upstream	684	215768 ~ 215839 (+)
trnal-uag_17	NA	non-coding	upstream	2222	214220 ~ 214301 (+)
trnal-uag_16	NA	non-coding	upstream	4009	212433 ~ 212514 (+)
trnal-uag_15	NA	non-coding	upstream	5618	210824 ~ 210905 (+)
trnal-uag_14	NA	non-coding	upstream	7263	209179 ~ 209260 (+)
trnam-cau_53	NA	non-coding	downstream	1470	218075 ~ 218146 (+)
G181247	NA	non-coding	downstream	314498	531103 ~ 579197 (+)
G181261	NA	non-coding	downstream	383091	599696 ~ 599937 (+)
G181284	NA	non-coding	downstream	410686	627291 ~ 628052 (+)
G181286	NA	non-coding	downstream	420378	636983 ~ 637378 (+)
LOC120547162	katna1,LOC104968001	other	downstream	654476	871081 ~ 896358 (+)
slc16a10	slc16a10,LOC106607741	other	downstream	970497	1187102 ~ 1239126 (+)
marcksa	marcks	other	downstream	1728953	1945558 ~ 2011423 (+)
nt5dc1	nt5dc1,LOC102795200	other	downstream	2171401	2388006 ~ 2497160 (+)
dse	dse,LOC102795484	other	downstream	2286163	2502768 ~ 2533772 (+)