G195361 (lmbrd1)


Basic Information

Item Value
gene id G195361
gene name lmbrd1
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053130.1
NCBI id CM020927.1
chromosome length 36824488
location 20176520 ~ 20177637 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU265283
TGGCTGCCATACATGACATACTGTGGGGCTAGGCTGTAGATCATGTAGCTGGTGTGAAGGACAATCAAGAGAAGAATCATACACAGGAAGAGAAGAGCCTGGGGGCGAGTTTTCTTTGGTCTTATTTTGTACAGCCTTATCCAGAAGAACCAGATGCCCATGTTGCGAATGCCAGCCATGGAGGTGACTACAAAGTACATGGTGATGACTGTGATCAG

Function

symbol description
lmbrd1 Predicted to enable cobalamin binding activity. Predicted to be involved in protein localization to lysosome. Predicted to act upstream of or within insulin receptor internalization. Predicted to be located in clathrin-coated endocytic vesicle; endoplasmic reticulum membrane; and plasma membrane. Predicted to be active in lysosomal membrane. Human ortholog(s) of this gene implicated in methylmalonic aciduria and homocystinuria type cblF. Orthologous to human LMBRD1 (LMBR1 domain containing 1).

NR:

description
PREDICTED: probable lysosomal cobalamin transporter

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU265283 True 218 lncRNA 0.47 2 20176520 20177637

Neighbor

gene id symbol gene type direction distance location
phf3 NA coding upstream 377587 19785607 ~ 19798933 (+)
si:dkey-103j14.5 LOC103355085 coding upstream 393760 19777291 ~ 19782760 (+)
prim2 prim2,LOC102784181 coding upstream 504803 19646681 ~ 19671717 (+)
bag2 bag2 coding upstream 536364 19637451 ~ 19640156 (+)
znf451 NA coding upstream 540111 19627536 ~ 19636409 (+)
LOC120548537 col19a1 coding downstream 56902 20234539 ~ 20330222 (+)
fam135a fam135a coding downstream 178024 20355661 ~ 20371543 (+)
trnaw-cca_26 NA coding downstream 200575 20378212 ~ 20378283 (+)
zgc:172136 frmd1,LOC104965675,LOC102789325 coding downstream 203794 20381431 ~ 20392648 (+)
tarbp1 tarbp1 coding downstream 215426 20393063 ~ 20407170 (+)
G195285 NA non-coding upstream 408203 19768074 ~ 19768317 (+)
LOC120548551 NA non-coding upstream 815304 19358047 ~ 19361216 (+)
G195115 gclc non-coding upstream 901298 19272600 ~ 19275222 (+)
G195087 NA non-coding upstream 957478 19218736 ~ 19219042 (+)
G195086 NA non-coding upstream 958102 19216483 ~ 19218418 (+)
G195511 NA non-coding downstream 467673 20645310 ~ 20658889 (+)
G195520 NA non-coding downstream 592257 20769894 ~ 20770215 (+)
G195565 NA non-coding downstream 1087648 21265285 ~ 21265663 (+)
G195570 NA non-coding downstream 1101210 21278847 ~ 21280312 (+)
G195575 foxn2 non-coding downstream 1107794 21285431 ~ 21289210 (+)
adgrb3 adgrb3 other upstream 19572 20041774 ~ 20156948 (+)
gfral NA other upstream 746424 19426475 ~ 19430096 (+)
zgc:163080 tmem14a other upstream 960097 19212832 ~ 19216423 (+)
mcph1 mcph1,LOC102776803 other upstream 976515 19167986 ~ 19200005 (+)
G195036 LOC103369008,LOC106520712 other upstream 1044579 19126220 ~ 19131941 (+)
G195448 thbs2 other downstream 352130 20529767 ~ 20530315 (+)
G195518 NA other downstream 575136 20752773 ~ 20753809 (+)
fbxo11a fbxo11,LOC104951339 other downstream 1140973 21318610 ~ 21332577 (+)
G195653 LOC102296834 other downstream 1336889 21514526 ~ 21515128 (+)
kif16bb NA other downstream 1977765 22155402 ~ 22184492 (+)

Expression


Co-expression Network