G197852 (neto1,LOC101071133)


Basic Information

Item Value
gene id G197852
gene name neto1,LOC101071133
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053130.1
NCBI id CM020927.1
chromosome length 36824488
location 30442646 ~ 30443121 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU268528
TGTTGATGGTCTGTGCCAGTTACTTCACACCGGGGCTTCGAGATACCCCAGTGGGCTAGTAACGTCCCGGCAGTCATAAAACACCTTCCGTCCGATCAGATCTAGAGAGCGGAGTTATGGCTGTCCCAATCCAGCACAGACCTTCAGGAGCCAACTCTTGGGCTACGATGGGATTGTCTCCGTGACAGCCTGAAGTACAAACATAGACCCGTGGAGAGAACTGAACCAACGTTGAGGAACGTTTACAAGGTACTTGCCTGCCAATATGACCCGCTAGGCTATATCGTACCATTTACCACCAGAGCCAAGATCCTAGTTCAGGATCTTTGGAGGGAACAAATCGGCTGGGATGACCCGATTCAGCCACAGAGCCTCCGTGACAGATGGCTTGCCTGGGAACGGGAGATTCCAGACCTCGTCCAGATGGAAATCCCCAGATGTTATGCACCAGCGTCTACAGACTTACCGACATCCAG

Function

symbol description
neto1 Predicted to act upstream of or within regulation of neuronal synaptic plasticity. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human NETO1 (neuropilin and tolloid like 1).

NR:

description
PREDICTED: uncharacterized protein LOC101071133

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU268528 True 476 lncRNA 0.53 1 30442646 30443121

Neighbor

gene id symbol gene type direction distance location
nvl NA coding upstream 106486 30267788 ~ 30336160 (+)
cdt1 NA coding upstream 479556 29956720 ~ 29963090 (+)
pcca pcca coding upstream 744503 29659412 ~ 29698143 (+)
LOC120548236 LOC103357099,LOC103387711 coding upstream 787595 29646723 ~ 29655051 (+)
LOC120547721 LOC103357097 coding upstream 809885 29628731 ~ 29632761 (+)
sertad2b sertad2,LOC104932742 coding downstream 62933 30506054 ~ 30600609 (+)
slc1a4 slc1a4,LOC102791775 coding downstream 182509 30625630 ~ 30671184 (+)
LOC120548109 LOC102195401,LOC103353517,LOC102300597,LOC106939791 coding downstream 268452 30711573 ~ 31005023 (+)
ogfrl1 ogfrl1,LOC104917660,LOC103363704,LOC100701482 coding downstream 740199 31183320 ~ 31198691 (+)
LOC120547952 rims1,LOC102777706,LOC102298248 coding downstream 899838 31342959 ~ 31493220 (+)
G197860 LOC101071133 non-coding upstream 2603 30439671 ~ 30440043 (+)
G197859 NA non-coding upstream 3158 30439283 ~ 30439488 (+)
G197858 NA non-coding upstream 3510 30438847 ~ 30439136 (+)
G197856 NA non-coding upstream 4272 30437286 ~ 30438374 (+)
LOC120548213 NA non-coding upstream 5487 30430600 ~ 30437159 (+)
G197862 NA non-coding downstream 9477 30452598 ~ 30452931 (+)
G197864 NA non-coding downstream 11340 30454461 ~ 30454668 (+)
G197865 NA non-coding downstream 11710 30454831 ~ 30455229 (+)
G197867 NA non-coding downstream 15551 30458672 ~ 30459448 (+)
G197877 NA non-coding downstream 34219 30477340 ~ 30477574 (+)
LOC120547658 NA other upstream 240826 30153511 ~ 30201820 (+)
LOC120547718 LOC102789565,LOC100690068,LOC101471749,LOC103357097 other upstream 823630 29518941 ~ 29619016 (+)
G197531 NA other upstream 1092718 29348425 ~ 29349928 (+)
LOC120548242 ccdc85a,LOC104955469,LOC102783086,LOC102310250,LOC102209339,LOC100696856 other upstream 1265152 29112688 ~ 29177494 (+)
ccnj ccnj,LOC102785723 other upstream 2140313 28294205 ~ 28302333 (+)
G197999 NA other downstream 791243 31234364 ~ 31234723 (+)
G198185 NA other downstream 2350167 32793288 ~ 32794661 (+)
G198245 rab1a,LOC104962072,LOC102231865 other downstream 2519267 32962388 ~ 32965074 (+)
slc2a15a LOC103367959,LOC104935160,LOC103476520,LOC106961144,LOC103155793 other downstream 2714608 33157729 ~ 33199862 (+)
si:ch211-51a6.2 LOC104924867,LOC103357113,LOC100694100 other downstream 3538390 33981511 ~ 34008003 (+)

Expression


Co-expression Network