G198102


Basic Information

Item Value
gene id G198102
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053130.1
NCBI id CM020927.1
chromosome length 36824488
location 32445895 ~ 32446422 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU268805
aaacagttcacatcacctgcaaaactcattcaaagcaacacaactcttaacacacgtctcaaaacaggctcagtgcagccaaacactatgaacaatcctcactgagataacacacactgtcactcagaacacactgaggggggaaaaaaactaaaggtacgtaacagtaccaaagaatagtgtgactaatcctgcctctctccagcatcatgtggcaagttttcttcatcacattggatgtctgcatcatctctaaatactaatgaatgtggtgtttctattgctttcacctccattactttctgaaa

Function

GO:

id name namespace
GO:0052548 regulation of endopeptidase activity biological_process

KEGG:

id description
ko00830 Retinol metabolism
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU268805 True 308 lncRNA 0.41 2 32445895 32446422

Neighbor

gene id symbol gene type direction distance location
bcl11aa bcl11a,LOC103363701,LOC102779517 coding upstream 872274 31512864 ~ 31573621 (+)
LOC120547952 rims1,LOC102777706,LOC102298248 coding upstream 952675 31342959 ~ 31493220 (+)
ogfrl1 ogfrl1,LOC104917660,LOC103363704,LOC100701482 coding upstream 1247204 31183320 ~ 31198691 (+)
LOC120548109 LOC102195401,LOC103353517,LOC102300597,LOC106939791 coding upstream 1440872 30711573 ~ 31005023 (+)
slc1a4 slc1a4,LOC102791775 coding upstream 1774711 30625630 ~ 30671184 (+)
LOC120547814 NA coding downstream 210564 32656986 ~ 32659866 (+)
LOC120547622 NA coding downstream 215665 32662087 ~ 32666672 (+)
LOC120547668 LOC106676435,LOC106674820 coding downstream 333094 32779516 ~ 32783434 (+)
fgf8a fgf8,LOC104933818,LOC106515330,LOC108239148 coding downstream 804366 33250788 ~ 33258175 (+)
fbxw4 NA coding downstream 832550 33278972 ~ 33355371 (+)
G198100 NA non-coding upstream 3156 32442532 ~ 32442739 (+)
G198095 NA non-coding upstream 496970 31948621 ~ 31948925 (+)
G198091 NA non-coding upstream 516915 31928769 ~ 31928980 (+)
G198090 NA non-coding upstream 593281 31852290 ~ 31852614 (+)
G198089 NA non-coding upstream 696987 31748673 ~ 31748908 (+)
G198126 NA non-coding downstream 135298 32581720 ~ 32583279 (+)
G198134 NA non-coding downstream 166250 32612672 ~ 32613005 (+)
G198138 NA non-coding downstream 179751 32626173 ~ 32626511 (+)
LOC120548258 NA non-coding downstream 183892 32630314 ~ 32632849 (+)
G198147 NA non-coding downstream 193564 32639986 ~ 32640929 (+)
G197999 NA other upstream 1211172 31234364 ~ 31234723 (+)
LOC120547658 NA other upstream 2244075 30153511 ~ 30201820 (+)
LOC120547718 LOC102789565,LOC100690068,LOC101471749,LOC103357097 other upstream 2826879 29518941 ~ 29619016 (+)
G197531 NA other upstream 3095967 29348425 ~ 29349928 (+)
LOC120548242 ccdc85a,LOC104955469,LOC102783086,LOC102310250,LOC102209339,LOC100696856 other upstream 3268401 29112688 ~ 29177494 (+)
G198185 NA other downstream 346866 32793288 ~ 32794661 (+)
G198245 rab1a,LOC104962072,LOC102231865 other downstream 515966 32962388 ~ 32965074 (+)
slc2a15a LOC103367959,LOC104935160,LOC103476520,LOC106961144,LOC103155793 other downstream 711307 33157729 ~ 33199862 (+)
si:ch211-51a6.2 LOC104924867,LOC103357113,LOC100694100 other downstream 1535089 33981511 ~ 34008003 (+)
LOC120548523 NA other downstream 2448761 34895183 ~ 34948460 (+)

Expression


Co-expression Network