mrps6 (mrps6,LOC102780815)


Basic Information

Item Value
gene id mrps6
gene name mrps6,LOC102780815
gene type coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053130.1
NCBI id CM020927.1
chromosome length 36824488
location 21787187 ~ 21788905 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>XM_039784102.1
TTATTACGTCACTACAAAAGACCTTCCTCTCCCTCGTGTCATAACCATGGTCATAACATGTCTTTTAACTGAGTGATCTGGCAATGACATCAACCCATTGCCAGCTGAATTAAATTTGTGAATCGAGGATTTGTTTGCCGAAGCCATGCCTCGCTACGAACTGGCCCTGATCCTGAAGGCGATGCAGCGCCCGGGGACATCGGCTGCTCTCCGGCGGACAGTGGAGACTTTGATGGAGCGGGGCGCGGTGGTGAGGGACCTGGAGAACTTGGGGGAGAGACTGTTGCCCTACACAATAACTAAACACAATCAGAGGCACAACAAAGGGGCTTACTTTCTGGTCGATTTCTACGCAGCCCCCAGCATCCTCACAGGTTTACTGGATCACCTTCACCGTGACGTGGACGTGGTGAGGCCCACTGTGCTGAAGAAGGACGCCCAGGTTTCCAGCAGTAACTGCTGTGGCCCCCAACAGTGATTTAATGTTTTCACAGCTCATATCCAGAAGATGTACAGTGTGATGCTTTCCTCTGACCTTTTCCATAGATGTTGACCTACATTTGGATGGAACAACATAATAAACTACTTTTCTATCTTA

Function

symbol description
mrps6 Predicted to enable small ribosomal subunit rRNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of mitochondrial small ribosomal subunit. Orthologous to human MRPS6 (mitochondrial ribosomal protein S6).

NR:

description
28S ribosomal protein S6, mitochondrial

GO:

id name namespace
GO:0006412 translation biological_process
GO:0005840 ribosome cellular_component
GO:0019843 rRNA binding molecular_function
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
K02990 RP-S6, MRPS6, rpsF; small subunit ribosomal protein S6

RNA

RNA id representative length rna type GC content exon number start site end site
XM_039784102.1 True 598 mRNA 0.49 2 21787187 21788905

Neighbor

gene id symbol gene type direction distance location
micu1 micu1 coding upstream 12312 21739841 ~ 21774875 (+)
pla2g12b NA coding upstream 134060 21649893 ~ 21653127 (+)
LOC120548353 NA coding upstream 141082 21639718 ~ 21646105 (+)
pde10a pde10a coding upstream 150080 21576456 ~ 21637107 (+)
tbxtb t coding upstream 216141 21565383 ~ 21571046 (+)
LOC120547713 psap,LOC104957284 coding downstream 2065 21790970 ~ 21800094 (+)
LOC120548288 NA coding downstream 237053 22025958 ~ 22033229 (+)
mrpl14 mrpl14,LOC102799944 coding downstream 281976 22070881 ~ 22072916 (+)
LOC120547561 LOC103358480,LOC103387545,LOC101064754,LOC103134145,LOC108234077,LOC106959257 coding downstream 299202 22088107 ~ 22094223 (+)
cfl1l NA coding downstream 310401 22099306 ~ 22101867 (+)
G195687 NA non-coding upstream 5748 21779247 ~ 21781439 (+)
G195685 NA non-coding upstream 8111 21731052 ~ 21779076 (+)
G195679 NA non-coding upstream 115712 21667615 ~ 21671475 (+)
G195650 NA non-coding upstream 239271 21546446 ~ 21547916 (+)
G195654 NA non-coding upstream 270746 21515758 ~ 21516441 (+)
G195711 tacc2,LOC104945673,LOC102313393 non-coding downstream 176780 21965685 ~ 22049812 (+)
G195749 NA non-coding downstream 263626 22052531 ~ 22056793 (+)
G195757 capn11,LOC103387546 non-coding downstream 292224 22081129 ~ 22083740 (+)
G195771 snx5 non-coding downstream 336645 22125550 ~ 22126288 (+)
G195783 NA non-coding downstream 353320 22142225 ~ 22144422 (+)
G195653 LOC102296834 other upstream 272059 21514526 ~ 21515128 (+)
fbxo11a fbxo11,LOC104951339 other upstream 454610 21318610 ~ 21332577 (+)
G195518 NA other upstream 1033378 20752773 ~ 20753809 (+)
G195448 thbs2 other upstream 1256872 20529767 ~ 20530315 (+)
adgrb3 adgrb3 other upstream 1630239 20041774 ~ 20156948 (+)
kif16bb NA other downstream 366497 22155402 ~ 22184492 (+)
tasp1 tasp1 other downstream 859009 22647914 ~ 22692604 (+)
disc1 disc1 other downstream 1773378 23562283 ~ 23611337 (+)
klhdc3 klhdc3 other downstream 2030009 23818914 ~ 23851605 (+)
LOC120547848 LOC103369904,LOC106907288,LOC107081732 other downstream 2569021 24357926 ~ 24367599 (+)

Expression


Co-expression Network