G206151



Basic Information


Item Value
gene id G206151
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053131.1
NCBI id CM020928.1
chromosome length 36057207
location 26284375 ~ 26284746 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU279212
cgatatcgacatacagttcgtcctggactacgtgtaagatcctaccgatcaccactctgtctttggctggtccgatctggatcagcggggaccggcgcagcagcgaggcgaagctgtgtttttgcccgggggaagagacgctgcggccggccacggggctctccgcctcccgctgccgccggagctcagattgctggtcgaaggcggcatatataatcataaaacacattgtcacctgttaaatgttatccattgcggtttgttcttttcatttcctctatcgaacataattaagcagtacaaaagtccggcatctttagcgttgatctgaatgcttcggacccctgttccaagatggcggcgggttttgac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU279212 True 372 lncRNA 0.53 1 26284375 26284746
Loading

Neighbor


gene id symbol gene type direction distance location
lrfn5a lrfn5,LOC103376550,LOC102799810 coding downstream 47696 26107688 ~ 26236679 (-)
LOC120549759 NA coding downstream 433986 25846794 ~ 25850389 (-)
LOC120549112 LOC103354036,LOC102215713,LOC102292014 coding downstream 499817 25763818 ~ 25784558 (-)
LOC120549285 LOC101487772,LOC100702802,LOC102799341,LOC107392602,LOC105939742,LOC107085779,LOC101078894 coding downstream 528705 25747994 ~ 25755670 (-)
LOC120549286 LOC100702802,LOC101487772,LOC107392602,LOC102799341,LOC105939742,LOC101078894 coding downstream 537666 25739705 ~ 25746709 (-)
gemin2 gemin2 coding upstream 557362 26842108 ~ 26847986 (-)
brms1la brms1l coding upstream 586297 26871043 ~ 26876821 (-)
LOC120549126 LOC104961455,LOC102797735,LOC102211125,LOC101469143 coding upstream 672209 26956955 ~ 26959609 (-)
psma6a psma6 coding upstream 695616 26980362 ~ 26985210 (-)
LOC120549239 NA coding upstream 700658 26985404 ~ 26996579 (-)
G206111 NA non-coding downstream 387184 25896816 ~ 25897191 (-)
LOC120549113 LOC103354038 non-coding downstream 488980 25791557 ~ 25795395 (-)
G205978 NA non-coding downstream 894986 25389151 ~ 25389389 (-)
G205941 NA non-coding downstream 1017340 25266831 ~ 25267035 (-)
G205937 NA non-coding downstream 1048654 25234296 ~ 25235721 (-)
G206182 NA non-coding upstream 338330 26623076 ~ 26653296 (-)
G206183 NA non-coding upstream 371141 26655887 ~ 26656097 (-)
G206195 fbxo33,LOC104952920,LOC102800092 non-coding upstream 530747 26815493 ~ 26816034 (-)
G206197 fbxo33 non-coding upstream 536533 26821279 ~ 26821536 (-)
G206199 NA non-coding upstream 544466 26829212 ~ 26832435 (-)
LOC120549744 NA other downstream 916508 25332890 ~ 25367867 (-)
gnmt gnmt other downstream 939721 25268304 ~ 25344654 (-)
G205866 marcksl1,LOC102222432,LOC104961040,LOC106610887,LOC105925978,LOC102786723 other downstream 1210251 25072355 ~ 25074124 (-)
G205845 bsdc1 other downstream 1327334 24953206 ~ 24957041 (-)
fndc5a fndc5,LOC108237574 other downstream 1407030 24843721 ~ 24877345 (-)
G206198 fbxo33,LOC102800092 other upstream 536942 26821688 ~ 26825064 (-)
LOC120549840 NA other upstream 1727293 28012039 ~ 28034752 (-)
LOC120549715 lrfn2,LOC103357516,LOC102785515 other upstream 1761459 28046205 ~ 28204448 (-)
G206919 ccdc88c other upstream 3649516 29934262 ~ 29934566 (-)
LOC120549387 NA other upstream 4397181 30681927 ~ 30703278 (-)

Expression


G206151 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G206151 Expression in each Bioproject

Bar chart with 8 bars.
G206151 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network