G207671



Basic Information


Item Value
gene id G207671
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053131.1
NCBI id CM020928.1
chromosome length 36057207
location 32498952 ~ 32499286 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU281181
ttcaggtgcattctgggcgtgctggtcttacagggaggtgtgttcaggtgcattctgggcgtgctggtcttacagggaggtgtgttcaggtgcattctgggcgtgctggtcttacagggaggtgtgttcaggtgcattctaggcgtgctggtcttacagggaggtgtgttcaggtgcattctgggcgtgctggtcttacagggaggtgtgttcaggtgcattctgggcgtgctggtcttacagggaggtgtgttcaggtgcattctgggcgtgctggtcttacagggaggtgtgttcaggtgcattctgggcgtgctggtcttacagggaggtgt

Function


GO:

id name namespace
GO:0019538 protein metabolic process biological_process
GO:0006508 proteolysis biological_process

KEGG:

id description
ko04080 Neuroactive ligand-receptor interaction
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption
ko05164 Influenza A

RNA


RNA id representative length rna type GC content exon number start site end site
TU281181 True 335 lncRNA 0.57 1 32498952 32499286

Neighbor


gene id symbol gene type direction distance location
LOC120549706 NA coding downstream 1521994 30971115 ~ 30976958 (-)
LOC120549705 NA coding downstream 1530872 30961020 ~ 30968080 (-)
ankrd6a NA coding downstream 1538659 30944479 ~ 30960293 (-)
LOC120549749 LOC103370732,LOC104968329,LOC104928167 coding downstream 1559549 30931136 ~ 30939403 (-)
LOC120548738 jkamp coding downstream 1711095 30777804 ~ 30787857 (-)
LOC120549825 afg3l2 coding upstream 188444 32687730 ~ 32690913 (-)
LOC120548945 NA coding upstream 461992 32961278 ~ 32964049 (-)
foxg1a foxg1,LOC106934576,LOC103147766,LOC102223528 coding upstream 804465 33303751 ~ 33305439 (-)
sptbn5 NA coding upstream 824321 33323607 ~ 33460847 (-)
LOC120549249 LOC103353941,LOC101078900 coding upstream 1009322 33508608 ~ 33524752 (-)
G207664 NA non-coding downstream 3676 32495039 ~ 32495276 (-)
G207662 NA non-coding downstream 37548 32461030 ~ 32461404 (-)
G207658 NA non-coding downstream 92607 32405068 ~ 32406345 (-)
G207648 akap6 non-coding downstream 229970 32268717 ~ 32268982 (-)
G207644 NA non-coding downstream 298728 32199842 ~ 32200224 (-)
G207672 NA non-coding upstream 22248 32521534 ~ 32523687 (-)
G207675 NA non-coding upstream 66471 32565757 ~ 32628368 (-)
G207676 NA non-coding upstream 66955 32566241 ~ 32566981 (-)
G207677 NA non-coding upstream 91621 32590907 ~ 32609291 (-)
G207678 NA non-coding upstream 95058 32594344 ~ 32594907 (-)
G207327 arhgap5 other downstream 519192 31975818 ~ 31979760 (-)
G207202 NA other downstream 1315397 31183023 ~ 31183555 (-)
LOC120549387 NA other downstream 1795674 30681927 ~ 30703278 (-)
G206919 ccdc88c other downstream 2564386 29934262 ~ 29934566 (-)
LOC120549715 lrfn2,LOC103357516,LOC102785515 other downstream 4294504 28046205 ~ 28204448 (-)
G207670 NA other upstream 110249 32609535 ~ 32691885 (-)
LOC120549602 klhl18,LOC102789664 other upstream 174667 32673953 ~ 32681902 (-)
LOC120548944 npas3 other upstream 360273 32859559 ~ 32932010 (-)
prkd1 prkd1,LOC107391660 other upstream 495072 32994358 ~ 33078319 (-)
G207741 NA other upstream 570975 33070261 ~ 33070727 (-)

Expression



Co-expression Network