G207780


Basic Information

Item Value
gene id G207780
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053131.1
NCBI id CM020928.1
chromosome length 36057207
location 33370276 ~ 33370696 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU281378
gtcaggacacgccctcatactctgcttctgactggctagtagtccttacctaggtactgtcagggcacgccctcatactctgctcctgactggctagtagtccttacctagctactgtcagggcacgccctcatactctgctcctgactggctagtagtccttacctagctactgtcagggcacgccctcatactctgcttctgactggctagtagtccttacctaggtactgtcagggcacgccctt

Function

GO:

id name namespace
GO:0005581 collagen trimer cellular_component

KEGG:

id description
ko04151 PI3K-Akt signaling pathway
ko04512 ECM-receptor interaction
ko04510 Focal adhesion
ko04974 Protein digestion and absorption
ko05165 Human papillomavirus infection

RNA

RNA id representative length rna type GC content exon number start site end site
TU281378 True 248 lncRNA 0.55 2 33370276 33370696

Neighbor

gene id symbol gene type direction distance location
foxg1a foxg1,LOC106934576,LOC103147766,LOC102223528 coding downstream 64837 33303751 ~ 33305439 (-)
LOC120548945 NA coding downstream 406227 32961278 ~ 32964049 (-)
LOC120549825 afg3l2 coding downstream 679363 32687730 ~ 32690913 (-)
LOC120549706 NA coding downstream 2393318 30971115 ~ 30976958 (-)
LOC120549705 NA coding downstream 2402196 30961020 ~ 30968080 (-)
LOC120549249 LOC103353941,LOC101078900 coding upstream 137912 33508608 ~ 33524752 (-)
coch coch,LOC102779905 coding upstream 223372 33594068 ~ 33623644 (-)
LOC120549318 LOC104924818,LOC103353924,LOC102795936,LOC101485054 coding upstream 870130 34240826 ~ 34256495 (-)
LOC120549317 LOC103353926 coding upstream 891511 34262207 ~ 34273793 (-)
LOC120549319 NA coding upstream 999154 34369850 ~ 34370808 (-)
G207767 NA non-coding downstream 7974 33318952 ~ 33362302 (-)
G207768 NA non-coding downstream 47253 33320784 ~ 33323023 (-)
G207766 NA non-coding downstream 55300 33313602 ~ 33314976 (-)
G207755 NA non-coding downstream 85529 33196434 ~ 33284747 (-)
G207747 NA non-coding downstream 115613 33150281 ~ 33254663 (-)
G207781 NA non-coding upstream 2688 33373384 ~ 33376194 (-)
G207788 NA non-coding upstream 64523 33435219 ~ 33435643 (-)
G207794 NA non-coding upstream 108287 33478983 ~ 33488420 (-)
G207809 NA non-coding upstream 179067 33549763 ~ 33571433 (-)
G207801 NA non-coding upstream 276005 33646701 ~ 33683064 (-)
G207742 NA other downstream 220983 33094185 ~ 33149293 (-)
prkd1 prkd1,LOC107391660 other downstream 291957 32994358 ~ 33078319 (-)
G207741 NA other downstream 299549 33070261 ~ 33070727 (-)
LOC120548944 npas3 other downstream 438266 32859559 ~ 32932010 (-)
LOC120549602 klhl18,LOC102789664 other downstream 688374 32673953 ~ 32681902 (-)
G207802 NA other upstream 120877 33491573 ~ 33498532 (-)
ehd4 LOC107391916,LOC105938093,LOC106527300,LOC102223325,LOC103156172,LOC103382107,LOC101073507 other upstream 161791 33532487 ~ 33647324 (-)
G207808 NA other upstream 162781 33533477 ~ 33611751 (-)
scfd1 scfd1,LOC105419774,LOC105419155,LOC107719485 other upstream 262283 33632979 ~ 33702742 (-)
g2e3 g2e3,LOC102781532 other upstream 339167 33709863 ~ 33731941 (-)

Expression


Co-expression Network