G210026


Basic Information

Item Value
gene id G210026
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053132.1
NCBI id CM020929.1
chromosome length 33651559
location 5191999 ~ 5192806 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU284603
ccacactcgacagcaggtaacgttagcctaccgttagctagttaacaccacactcgacagcaggtaacgttagcctaccgttagctagttaacaccacactcgacagcaggtaacgttagcctaccgttagctagttaacaccacactcgacagcaggtaacgttagcctaccgttagctagttaacaccacactcgacagcaggtaacgttagcctaccgttagctagttaacaccacactcgacag

Function

GO: NA

KEGG:

id description
ko00140 Steroid hormone biosynthesis
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA

RNA id representative length rna type GC content exon number start site end site
TU284603 True 248 lncRNA 0.50 2 5191999 5192806

Neighbor

gene id symbol gene type direction distance location
ccr10 NA coding upstream 4337 5146612 ~ 5187662 (+)
LOC120551710 LOC107101850 coding upstream 68395 5120089 ~ 5123604 (+)
exoc7 exoc7,LOC102778721 coding upstream 85512 5079945 ~ 5106487 (+)
tvp23b LOC104952594 coding upstream 113752 5070895 ~ 5078247 (+)
trim16 LOC102784917 coding upstream 124296 5051348 ~ 5067703 (+)
fmnl1b LOC103367392 coding downstream 5945 5198751 ~ 5249758 (+)
LOC120550764 kansl1 coding downstream 510539 5703345 ~ 5741047 (+)
LOC120550766 LOC104937335,LOC104962506,LOC105006852,LOC106579281 coding downstream 610638 5803444 ~ 5844268 (+)
LOC120551191 LOC100697881,LOC102194592,LOC102300228,LOC101486561,LOC104965354,LOC103398847 coding downstream 730535 5923341 ~ 6019166 (+)
LOC120551300 LOC100698148,LOC102195172,LOC103398848 coding downstream 832766 6025572 ~ 6042915 (+)
G210006 LOC103373963,LOC102232678,LOC105926434,LOC103150794,LOC103481593,LOC107753270 non-coding upstream 78613 5113161 ~ 5113386 (+)
G209968 NA non-coding upstream 129343 5062363 ~ 5062656 (+)
G209931 NA non-coding upstream 161975 4975929 ~ 5030024 (+)
G209906 NA non-coding upstream 287693 4904098 ~ 4904306 (+)
G209905 NA non-coding upstream 291002 4900770 ~ 4900997 (+)
G210027 NA non-coding downstream 3449 5196255 ~ 5196603 (+)
G210030 NA non-coding downstream 31234 5224040 ~ 5229881 (+)
G210070 NA non-coding downstream 155298 5348104 ~ 5376130 (+)
G210072 NA non-coding downstream 161635 5354441 ~ 5360808 (+)
G210081 NA non-coding downstream 242243 5435049 ~ 5435714 (+)
map2k6 LOC103367941,LOC105926483,LOC102221885,LOC100697345,LOC103150707 other upstream 475416 4674237 ~ 4716583 (+)
LOC120551345 plekha1,LOC106957628 other upstream 1163717 3998373 ~ 4028282 (+)
LOC120550571 NA other upstream 1368748 3818853 ~ 3823251 (+)
G209514 NA other upstream 1545002 3646009 ~ 3646997 (+)
G209344 NA other upstream 2358325 2671275 ~ 2833674 (+)
LOC120550763 LOC100696279,LOC101467831,LOC107093968 other downstream 398529 5591335 ~ 5687896 (+)
LOC120551158 NA other downstream 622430 5815236 ~ 6259659 (+)
kctd2 kctd2,LOC102796578,LOC107089511,LOC103371831,LOC103398851,LOC106521991 other downstream 890296 6083102 ~ 6092738 (+)
LOC120551157 NA other downstream 1027063 6219869 ~ 6270445 (+)
stx4 stx4 other downstream 1185330 6378136 ~ 6392578 (+)

Expression


Co-expression Network