G218571 (LOC102785356,LOC102298937,LOC101486668,LOC102080962,LOC102192826)


Basic Information

Item Value
gene id G218571
gene name LOC102785356,LOC102298937,LOC101486668,LOC102080962,LOC102192826
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053133.1
NCBI id CM020930.1
chromosome length 31697812
location 8753511 ~ 8754861 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU295823
GTCATCGATCATGCGGTCCATTTGGCTGATCTCCTGCTCCATGGTGCTGCGCTCCTGGCTCTCCAGCCCAGCAGGGAGGGTTGGGTTTGGAGCTATGTTCAGGTCTGGCAGACTGAGTGCTCGGGCTGCTACCTCACTGCCTCCCCCTTGTAGGCCAGTTTGCACGAGGGCATCGGTGTTGGCCAGAGAGAAGATGTCACTGATGTTGAAAACTTTGCACATGTCCACGTGGAGGAGCT

Function

NR:

description
PREDICTED: regulator of G-protein signaling 9-binding protein B-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU295823 True 239 lncRNA 0.57 2 8753511 8754861

Neighbor

gene id symbol gene type direction distance location
LOC120552044 anks6 coding downstream 18692 8724449 ~ 8734819 (-)
LOC120552041 ahrr coding downstream 40758 8639541 ~ 8712753 (-)
snx16 snx16 coding downstream 255497 8476127 ~ 8498014 (-)
LOC120552161 wwp1 coding downstream 335523 8378019 ~ 8417988 (-)
LOC120552414 LOC101468454,LOC102290369,LOC102196333,LOC103482264,LOC106914574 coding downstream 381174 8363474 ~ 8372337 (-)
ncf2 ncf2 coding upstream 13359 8768220 ~ 8779822 (-)
olfm3a olfm3,LOC103369880,LOC108250954 coding upstream 274262 9029123 ~ 9083108 (-)
col11a1a col11a1,LOC103148006 coding upstream 332290 9087151 ~ 9173024 (-)
LOC120552183 vav3,LOC102780841 coding upstream 859979 9614840 ~ 9726073 (-)
nrros NA coding upstream 1012731 9767592 ~ 9777716 (-)
G218568 NA non-coding downstream 3059 8749593 ~ 8750452 (-)
G218563 NA non-coding downstream 9202 8743847 ~ 8744309 (-)
G218561 NA non-coding downstream 13609 8737144 ~ 8739902 (-)
G218522 NA non-coding downstream 118826 8634100 ~ 8634685 (-)
G218503 NA non-coding downstream 157107 8547773 ~ 8596404 (-)
G218587 NA non-coding upstream 34967 8789828 ~ 8791965 (-)
G218588 NA non-coding upstream 41636 8796497 ~ 8796699 (-)
G218614 NA non-coding upstream 118091 8872952 ~ 8873160 (-)
G218639 NA non-coding upstream 185035 8939896 ~ 8940729 (-)
G218640 abca4,LOC103369882 non-coding upstream 193359 8948220 ~ 8949087 (-)
G218471 NA other downstream 322581 8430464 ~ 8430930 (-)
G218453 adarb2 other downstream 557632 8194929 ~ 8195879 (-)
G218085 LOC107687935 other downstream 3052935 5700229 ~ 5700576 (-)
G218019 NA other downstream 3716807 5027505 ~ 5036704 (-)
G217837 NA other downstream 4812182 3936010 ~ 3941329 (-)
prkdc prkdc other upstream 42920 8797781 ~ 8851726 (-)
LOC120551928 LOC104943218,LOC103369878,LOC100710535,LOC102301415,LOC101469805 other upstream 202548 8957409 ~ 8970638 (-)
cngb3.1 LOC103363254,LOC102786718,LOC108428960,LOC104948783 other upstream 1078601 9833462 ~ 9848241 (-)
G218950 NA other upstream 1822538 10577399 ~ 10669527 (-)
LOC120552013 NA other upstream 1849459 10604320 ~ 10615221 (-)

Expression


Co-expression Network