G222062 (cdh20,LOC103456703,LOC102782851)


Basic Information

Item Value
gene id G222062
gene name cdh20,LOC103456703,LOC102782851
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053133.1
NCBI id CM020930.1
chromosome length 31697812
location 24609461 ~ 24609679 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU300416
GGCAGCGTCCGGGTCCCTCGCCGACACCGTCTTCACCACCGTCCCGATCTCGGCGTCCTCTGACAGCTCGATGTAGTACGTCGTCGAGTCAAACAGCGGGGGCTCGTCCACGTCCTCCACGCTCACGTGCACAATGGTGACGTCCTTGAAGGGCCCGCGGTGGCGGAAGGCCGGGTCCAGTTTGGTGTTGGCGCCCTCCACCTTCAGAGTATAACTGGG

Function

symbol description
cdh20 Predicted to enable cadherin binding activity and calcium ion binding activity. Predicted to be involved in calcium-dependent cell-cell adhesion via plasma membrane cell adhesion molecules; cell morphogenesis; and cell-cell junction organization. Predicted to be integral component of membrane. Predicted to be part of catenin complex. Predicted to be active in adherens junction.

NR:

description
cadherin-20

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU300416 True 219 lncRNA 0.64 1 24609461 24609679

Neighbor

gene id symbol gene type direction distance location
mc4r LOC104930272,LOC103365861,LOC104961440 coding downstream 248245 24357609 ~ 24361216 (-)
drosha drosha coding downstream 311610 24193378 ~ 24297851 (-)
cdh10a LOC102783614,LOC100705471,LOC101477094,LOC102310056,LOC102199257 coding downstream 942604 23633683 ~ 23666857 (-)
LOC120552656 cdh18,LOC102310872 coding downstream 1301426 23128644 ~ 23308035 (-)
LOC120552718 NA coding downstream 1538564 23068720 ~ 23070897 (-)
rnf152 rnf152 coding upstream 50432 24660111 ~ 24723840 (-)
LOC120552289 NA coding upstream 154982 24764661 ~ 24770211 (-)
LOC120552302 NA coding upstream 162227 24771906 ~ 24777805 (-)
psme2 psme2 coding upstream 252831 24862510 ~ 24869834 (-)
emc9 emc9 coding upstream 308693 24918372 ~ 24923172 (-)
G222041 LOC104961439,LOC108234716,LOC107988374,LOC107089423 non-coding downstream 416661 24189134 ~ 24192800 (-)
G222039 NA non-coding downstream 431474 24177740 ~ 24177987 (-)
G222038 LOC104961439,LOC107383085 non-coding downstream 440912 24168312 ~ 24168549 (-)
G222037 LOC105920180,LOC107100491,LOC106522295,LOC107383085 non-coding downstream 456699 24152479 ~ 24152762 (-)
G222012 NA non-coding downstream 785783 23823353 ~ 23823678 (-)
G222088 NA non-coding upstream 185187 24794866 ~ 24795350 (-)
LOC120552180 NA non-coding upstream 284893 24894572 ~ 24904700 (-)
LOC120552179 NA non-coding upstream 318645 24928324 ~ 24954497 (-)
G223155 NA non-coding upstream 386947 24996626 ~ 25023914 (-)
G223181 NA non-coding upstream 397810 25007489 ~ 25011818 (-)
LOC120552322 cdh12,LOC108234660,LOC100695194,LOC101477368 other downstream 1089935 23401543 ~ 23519526 (-)
smpx smpx other downstream 2391080 22202767 ~ 22218381 (-)
LOC120552473 NA other downstream 2488850 22114382 ~ 22120611 (-)
tfr1b NA other downstream 2598375 21990017 ~ 22011086 (-)
rbis LOC101064519,LOC103367294,LOC102312013 other downstream 3387794 21217680 ~ 21221667 (-)
avl9 avl9 other upstream 186910 24796589 ~ 24854888 (-)
msl2b msl2,LOC102304425,LOC102778660 other upstream 353738 24963417 ~ 24968106 (-)
LOC120552232 LOC103371349 other upstream 426205 25035884 ~ 25086902 (-)
LOC120552299 NA other upstream 946794 25556473 ~ 25562540 (-)
LOC120552722 NA other upstream 1112811 25722490 ~ 25738940 (-)

Expression


Co-expression Network