G224228



Basic Information


Item Value
gene id G224228
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053133.1
NCBI id CM020930.1
chromosome length 31697812
location 31313315 ~ 31367136 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU303676
tcacacacaaagagacacacacacacagacacacagagacacacacacacagacacacagagacacacacacagagacacacacacacacacacacagacacacagagagacacacacacacacacacacacacagacacacacagac

Function


GO:

id name namespace
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU303676 True 148 lncRNA 0.49 2 31313315 31367136

Neighbor


gene id symbol gene type direction distance location
LOC120552143 NA coding downstream 74355 31233754 ~ 31238960 (-)
LOC120552642 NA coding downstream 210828 31098066 ~ 31102487 (-)
LOC120552139 NA coding downstream 506979 30797184 ~ 30806336 (-)
LOC120552744 prkag2,LOC107373612 coding downstream 714383 30579491 ~ 30598932 (-)
crygn2 crygn,LOC105025719 coding downstream 927309 30380109 ~ 30386006 (-)
LOC120552533 NA non-coding downstream 1001 31284694 ~ 31312314 (-)
G224241 NA non-coding downstream 4087 31297370 ~ 31309228 (-)
G224226 NA non-coding downstream 29735 31256108 ~ 31283580 (-)
G224194 NA non-coding downstream 104524 31207908 ~ 31208791 (-)
G224158 NA non-coding downstream 141514 31162729 ~ 31171801 (-)
G224211 NA non-coding upstream 14607 31381743 ~ 31459095 (-)
G224219 NA non-coding upstream 28328 31395464 ~ 31473602 (-)
G224257 NA non-coding upstream 40146 31407282 ~ 31408465 (-)
G224221 NA non-coding upstream 68125 31435261 ~ 31481460 (-)
G224217 NA non-coding upstream 99407 31466543 ~ 31468413 (-)
G224245 NA other downstream 12283 31300023 ~ 31301032 (-)
G224195 NA other downstream 101955 31210761 ~ 31211360 (-)
LOC120552646 NA other downstream 293129 31017830 ~ 31020186 (-)
G224051 NA other downstream 631733 30632746 ~ 30681582 (-)
LOC120552614 NA other downstream 819936 30446866 ~ 30493379 (-)
epb41l3a LOC100705796,LOC102304920,LOC101475436,LOC102201773,LOC108251472,LOC107100932 other upstream 93495 31460631 ~ 31511341 (-)
G224289 NA other upstream 248934 31616070 ~ 31681892 (-)

Expression



Co-expression Network