G229872 (pmpcb)



Basic Information


Item Value
gene id G229872
gene name pmpcb
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053134.1
NCBI id CM020931.1
chromosome length 29109922
location 23538248 ~ 23560342 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU311811
GGGGCCTTTGTAGTGAGTGGTGATGTACTCCACCAGGTCTCCTCTGTTGATGGTCTTGATGTTCTCTGTGGGGCCCAGGATGGTCCTGCCCAGAGCTGTGGACTGGTACGCAGTAGCATGCAGGTAATCAAAAACCACTTCCTGCAGATTGGTCTCTACTTCCTGCATCTCTCTGAGGATCACCCCTCGCTCCCTCTCAATCTCTGCCTCGCCCAGCGTGCTGTTCTGGATGATGTCGGCCAGGATCTCCACGGCTTGGGAGAAAGAAAACACGGAAAATTGGATTTACA

Function


symbol description
pmpcb Predicted to enable metalloendopeptidase activity. Predicted to be involved in protein processing involved in protein targeting to mitochondrion. Predicted to act upstream of or within proteolysis. Predicted to be part of mitochondrial processing peptidase complex. Predicted to be active in mitochondrion. Human ortholog(s) of this gene implicated in multiple mitochondrial dysfunctions syndrome 6. Orthologous to human PMPCB (peptidase, mitochondrial processing subunit beta).

NR:

description
PREDICTED: mitochondrial-processing peptidase subunit beta

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU311811 True 290 lncRNA 0.53 2 23538248 23560342

Neighbor


gene id symbol gene type direction distance location
phax NA coding downstream 6441 23529757 ~ 23531807 (-)
cmah LOC101476433,LOC102306063,LOC100691852,LOC101466628,LOC102209249,LOC102786627,LOC103459632 coding downstream 262705 23229083 ~ 23275543 (-)
LOC120553577 NA coding downstream 350486 23177186 ~ 23187762 (-)
LOC120553037 NA coding downstream 421827 23092819 ~ 23116421 (-)
LOC120553034 NA coding downstream 596129 22920182 ~ 22942119 (-)
dnajc2 dnajc2 coding upstream 1818 23562160 ~ 23588760 (-)
slc26a5 NA coding upstream 34010 23594352 ~ 23617076 (-)
cbll1 cbll1 coding upstream 116826 23677168 ~ 23684068 (-)
sbf1 sbf1 coding upstream 157997 23718339 ~ 23809346 (-)
glt8d2 glt8d2 coding upstream 307814 23868156 ~ 23885592 (-)
G229867 NA non-coding downstream 10709 23527105 ~ 23527539 (-)
G229802 NA non-coding downstream 124490 23413116 ~ 23413758 (-)
G229774 NA non-coding downstream 225162 23298709 ~ 23313086 (-)
G229784 NA non-coding downstream 251352 23285567 ~ 23286896 (-)
G229782 NA non-coding downstream 254197 23283529 ~ 23284051 (-)
LOC120553168 NA non-coding upstream 63238 23623580 ~ 23641504 (-)
G229908 NA non-coding upstream 142362 23702704 ~ 23707197 (-)
G229909 NA non-coding upstream 153114 23713456 ~ 23713677 (-)
G229952 NA non-coding upstream 386155 23946497 ~ 23948780 (-)
G229987 NA non-coding upstream 520185 24080527 ~ 24081153 (-)
G229716 NA other downstream 298675 23104760 ~ 23239573 (-)
glipr1a NA other downstream 327751 23203768 ~ 23210497 (-)
LOC120553090 NA other downstream 1727151 21771088 ~ 21811097 (-)
slc38a2 slc38a2 other downstream 2063646 21461076 ~ 21474602 (-)
ptprz1b NA other downstream 2392715 21063691 ~ 21145533 (-)
LOC120553170 NA other upstream 130177 23690519 ~ 23711804 (-)
G229907 NA other upstream 139355 23699697 ~ 23700198 (-)
LOC120553046 NA other upstream 297877 23858219 ~ 23863974 (-)
G229950 gdi2,LOC100708443,LOC102215003 other upstream 348214 23908556 ~ 23914692 (-)
sult4a1 sult4a1,LOC102784496 other upstream 1630919 25191261 ~ 25217693 (-)

Expression



Co-expression Network