G231430



Basic Information


Item Value
gene id G231430
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053135.1
NCBI id CM020932.1
chromosome length 21835524
location 1421082 ~ 1423428 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU313801
ctctgtgtgtgtgtctctgtctctgtgtgtgtgtgtgtgtctctgtctctgtgtgtgtgtctctgtgtgtgtgtgtctgtgtgtgtgtgtgtctctgtgtgtgtgtgtctctgtgtgtgtgtgtctgtgtgtgtgtgtgtgtgtgtgtgtctgtctctgtctgtgtgtgtgtgtgtctctctgtctctgtctgtctctctctgtctctgtgtgtgtcttctctgtgtgtgtgttaggtgtgtgtgtgtgtgtgtg

Function


GO:

id name namespace
GO:0005198 structural molecule activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU313801 True 255 lncRNA 0.50 3 1421082 1423428

Neighbor


gene id symbol gene type direction distance location
LOC120554760 LOC104931301,LOC102797872,LOC101477607,LOC102298835,LOC102210970 coding upstream 24505 1383910 ~ 1396577 (+)
LOC120554718 NA coding upstream 167507 1237578 ~ 1253575 (+)
LOC120554773 NA coding upstream 194833 1215027 ~ 1226249 (+)
LOC120554684 NA coding upstream 219685 1177375 ~ 1201397 (+)
LOC120554697 LOC103477383,LOC108241855,LOC107380983,LOC108242155,LOC108250349 coding upstream 275861 1143728 ~ 1145221 (+)
gbx2 gbx2,LOC102799445 coding downstream 54600 1478028 ~ 1482981 (+)
LOC120554628 NA coding downstream 310153 1733581 ~ 1743392 (+)
mlpha LOC107384560 coding downstream 325850 1749278 ~ 1781427 (+)
LOC120554028 NA coding downstream 385717 1809145 ~ 1810702 (+)
LOC120554615 inhbb,LOC104931304,LOC101477046 coding downstream 405098 1828526 ~ 1839241 (+)
G231431 NA non-coding upstream 7698 1412948 ~ 1413384 (+)
G231429 NA non-coding upstream 8567 1411165 ~ 1412515 (+)
G231422 NA non-coding upstream 21510 1398585 ~ 1399572 (+)
G231419 NA non-coding upstream 73475 1346811 ~ 1347607 (+)
G231415 NA non-coding upstream 106003 1313359 ~ 1315079 (+)
G231437 NA non-coding downstream 36454 1459882 ~ 1518130 (+)
G231427 NA non-coding downstream 45488 1468916 ~ 1512021 (+)
G231441 NA non-coding downstream 73965 1497393 ~ 1498063 (+)
G231443 NA non-coding downstream 78948 1502376 ~ 1502768 (+)
G231454 NA non-coding downstream 128841 1552269 ~ 1552974 (+)
LOC120554625 NA other upstream 18028 1270784 ~ 1403054 (+)
LOC120554699 NA other upstream 193637 1068193 ~ 1227445 (+)
G231356 LOC102787331 other upstream 218128 1069687 ~ 1202954 (+)
G231269 NA other upstream 496669 906127 ~ 924413 (+)
LOC120554771 NA other upstream 572098 823340 ~ 848984 (+)
LOC120554068 agap1,LOC101478076 other downstream 44740 1468168 ~ 1521064 (+)
G231428 NA other downstream 63846 1487274 ~ 1496607 (+)
G231461 LOC107384560,LOC103366582 other downstream 292983 1716411 ~ 1791858 (+)
G231514 LOC101480717,LOC102290810,LOC102794459 other downstream 673447 2096875 ~ 2098749 (+)
sumo1 sumo1 other downstream 1065707 2489135 ~ 2494174 (+)

Expression



Co-expression Network