G236711



Basic Information


Item Value
gene id G236711
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053135.1
NCBI id CM020932.1
chromosome length 21835524
location 21373114 ~ 21373378 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU321185
agacacacacacacacacagagacagacagacagacagacagacacacacacacagagacagacacacacacacacagagacagacacacacacacagagacagacacacacacacacacagagacagacacacacacacacacagagacagacacacacacacacagagacacacacacacacacacacacacacacacacacacacacaca

Function


GO: NA

KEGG:

id description
ko04512 ECM-receptor interaction
ko04510 Focal adhesion
ko04974 Protein digestion and absorption

RNA


RNA id representative length rna type GC content exon number start site end site
TU321185 True 213 lncRNA 0.50 2 21373114 21373378

Neighbor


gene id symbol gene type direction distance location
LOC120554641 LOC103473932 coding downstream 223751 21126894 ~ 21149363 (-)
dytn NA coding downstream 297859 20965938 ~ 21075255 (-)
ftcd ftcd coding downstream 369845 20990890 ~ 21003269 (-)
vps16 vps16 coding downstream 505314 20853565 ~ 20867800 (-)
LOC120554361 NA coding downstream 570844 20794346 ~ 20802270 (-)
LOC120554016 NA coding upstream 278588 21651966 ~ 21691088 (-)
LOC120554648 NA coding upstream 327327 21700705 ~ 21725016 (-)
LOC120554669 LOC108250351,LOC103477372 non-coding downstream 15772 21355047 ~ 21357342 (-)
G236628 NA non-coding downstream 27931 21344701 ~ 21345183 (-)
LOC120554668 NA non-coding downstream 47616 21324435 ~ 21325498 (-)
G236695 NA non-coding downstream 138496 21217717 ~ 21234618 (-)
G236697 NA non-coding downstream 142847 21226798 ~ 21230267 (-)
G236618 NA non-coding upstream 2059 21375437 ~ 21381005 (-)
G236712 NA non-coding upstream 2747 21376125 ~ 21376884 (-)
G236713 NA non-coding upstream 4001 21377379 ~ 21378004 (-)
G236721 NA non-coding upstream 44718 21418096 ~ 21420001 (-)
G236723 NA non-coding upstream 49875 21423253 ~ 21423548 (-)
LOC120554013 LOC103366577 other downstream 130937 21200996 ~ 21242177 (-)
arl11 NA other downstream 421249 20940988 ~ 20951865 (-)
LOC120554644 NA other downstream 452616 20892914 ~ 20920498 (-)
G236646 NA other downstream 509803 20862680 ~ 20863311 (-)
rgn LOC103371141 other downstream 519731 20843492 ~ 20853383 (-)
LOC120554015 NA other upstream 261470 21634848 ~ 21651918 (-)
G236611 NA other upstream 300314 21673692 ~ 21674838 (-)

Expression



Co-expression Network