G24926 (hmbox1,LOC104919714)


Basic Information

Item Value
gene id G24926
gene name hmbox1,LOC104919714
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053114.1
NCBI id CM020911.1
chromosome length 46923577
location 1184725 ~ 1185227 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU33533
CCTCATCAAGTCCTCCACCTTGTCATCAACATCTAAGTCCTCTTCGCTGGTCTCGAACCCGTAGCCTGGCGCCGTGACACCGCCACTCACAACAGCAAGAGGAAACCGGGGAGGAGACAGCTTCCCGTTGGTGACAGCAACTAGGCCGTTCTGGACTACCGCTGCCATGGTGACAGGCGATGCTACTGGAATCGGTAGAAGCGGGGAGGCGGTGTCGAAGTTGTTATTAGGTGACGGGGAGAGTCGGTTGCTAGGGAAACTTGTCTGAGTGGCGGTGGAAGTCATGGAAGAAGAGGCGACGACGATACTGGAAGAAGACAAGGAAGACGAGGGAGGCATGTAGGGAGGCTTATGGGTCAACTTGTGTCCATGCTGGCGGTCCAGGTGGTCCAGGGTGTCCAGGGCGTGGAGGACCTCCACCTGTGTTATACCTGTCCTCCGTAGCCTCTGGAGGAGGTCAATCTGCTCGATGGTGAAACGAGGCTCCTCACACTGCTGGAACA

Function

symbol description
hmbox1 Enables double-stranded telomeric DNA binding activity; identical protein binding activity; and sequence-specific double-stranded DNA binding activity. Involved in negative regulation of transcription by RNA polymerase II; positive regulation of telomerase activity; and positive regulation of telomere maintenance via telomerase. Located in several cellular components, including centrosome; chromosome, telomeric region; and nuclear body.

NR:

description
PREDICTED: homeobox-containing protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU33533 True 503 lncRNA 0.57 1 1184725 1185227

Neighbor

gene id symbol gene type direction distance location
kif13ba LOC103358451,LOC107099140,LOC107397337 coding upstream 21707 1103597 ~ 1163018 (+)
mrps11 LOC107594750 coding upstream 147232 1030354 ~ 1037493 (+)
LOC120556381 akap13,LOC103359499,LOC102788190 coding upstream 713995 349112 ~ 470730 (+)
LOC120555942 NA coding upstream 896402 278096 ~ 288323 (+)
LOC120555941 LOC103359503,LOC100696673 coding upstream 908628 251471 ~ 276097 (+)
eprs1 eprs,LOC102787790 coding downstream 19267 1204494 ~ 1227658 (+)
glo1 glo1,LOC103369175,LOC104919745 coding downstream 43190 1228417 ~ 1240457 (+)
LOC120555232 NA coding downstream 61658 1246885 ~ 1251901 (+)
LOC120555381 LOC102205592,LOC102787001,LOC102297232,LOC101476278,LOC100534518 coding downstream 77723 1262950 ~ 1269003 (+)
LOC120555491 NA coding downstream 123595 1308822 ~ 1311760 (+)
G24920 LOC104919714 non-coding upstream 6544 1175326 ~ 1178181 (+)
G24918 NA non-coding upstream 15030 1165649 ~ 1169695 (+)
G24923 NA non-coding upstream 50123 1134061 ~ 1134602 (+)
G24890 NA non-coding upstream 237665 946797 ~ 947060 (+)
LOC120555975 NA non-coding upstream 410027 765198 ~ 774698 (+)
G24972 NA non-coding downstream 67970 1253197 ~ 1254591 (+)
G24984 NA non-coding downstream 73292 1258519 ~ 1258816 (+)
G24991 NA non-coding downstream 117492 1302719 ~ 1302952 (+)
G25011 NA non-coding downstream 200821 1386048 ~ 1386264 (+)
G25008 NA non-coding downstream 227868 1413095 ~ 1415747 (+)
mapk8ip1b mapk8ip1,LOC102793463 other upstream 1100299 11843 ~ 84426 (+)
G25173 dnaja2,LOC106524269 other downstream 654106 1839333 ~ 1842811 (+)
G25204 NA other downstream 896731 2081958 ~ 2083319 (+)
adamts18 adamts18 other downstream 1055187 2240414 ~ 2312157 (+)
mmp15b mmp15,LOC104948393 other downstream 2296070 3481297 ~ 3518086 (+)
G25431 NA other downstream 2599706 3784933 ~ 3785542 (+)

Expression


Co-expression Network