G26211 (cemip,LOC103130034)


Basic Information

Item Value
gene id G26211
gene name cemip,LOC103130034
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053114.1
NCBI id CM020911.1
chromosome length 46923577
location 8775447 ~ 8775662 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU35089
CTGTGCGTAGCGGCCGCTGCAGATAGCAGCCTTCCAGTCGGGCACGTCAATGCAGTCGGGGTGCCGGAGCAGCCAGTTGTCCTCTTTGACCAGGAAGGCTCCGGGATACTCGCTGACCGAGCCGTCAATGTCGTGGAAGATGGTCGTCTTGTCCCCGTCCATCTGCATCTTATTAAACCAGGGCCCCGGCTCCCCAAAGAACACCCGAGACGTGAG

Function

symbol description
cemip Orthologous to human CEMIP (cell migration inducing hyaluronidase 1).

NR:

description
PREDICTED: cell migration-inducing and hyaluronan-binding protein-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU35089 True 216 lncRNA 0.61 1 8775447 8775662

Neighbor

gene id symbol gene type direction distance location
mesd mesdc2 coding upstream 24567 8745162 ~ 8750880 (+)
stard5 stard5 coding upstream 153735 8604276 ~ 8621712 (+)
LOC120556467 tmc3 coding upstream 173769 8545261 ~ 8601678 (+)
mex3b mex3b coding upstream 628520 8140884 ~ 8146927 (+)
efl1 efl1 coding upstream 705780 7939212 ~ 8069667 (+)
abhd17c abhd17c,LOC102793890,LOC100694079 coding downstream 280671 9056333 ~ 9091510 (+)
LOC120556464 NA coding downstream 485549 9261211 ~ 9296717 (+)
lins1 NA coding downstream 856345 9632007 ~ 9642958 (+)
lrrk1 lrrk1 coding downstream 1085490 9861152 ~ 10096639 (+)
LOC120555943 LOC103372586 coding downstream 1649501 10425163 ~ 10465554 (+)
G26210 cemip non-coding upstream 2122 8773080 ~ 8773325 (+)
G26208 NA non-coding upstream 8204 8767036 ~ 8767243 (+)
G26207 NA non-coding upstream 8460 8766562 ~ 8766987 (+)
G26206 NA non-coding upstream 13157 8761965 ~ 8762290 (+)
LOC120555519 NA non-coding upstream 276591 8497892 ~ 8498856 (+)
G26216 NA non-coding downstream 37166 8812828 ~ 8813032 (+)
G26217 NA non-coding downstream 40745 8816407 ~ 8816616 (+)
G26218 NA non-coding downstream 45091 8820753 ~ 8820984 (+)
G26273 NA non-coding downstream 460690 9236352 ~ 9238565 (+)
G26276 NA non-coding downstream 465003 9240665 ~ 9244453 (+)
G26205 NA other upstream 15146 8753701 ~ 8760301 (+)
LOC120556365 LOC102793592,LOC103366350,LOC101487888,LOC102307622,LOC100694289 other upstream 1769769 6993956 ~ 7005678 (+)
rwdd3 rwdd3 other upstream 2379741 6382570 ~ 6395706 (+)
LOC120555541 NA other upstream 2485671 6262410 ~ 6289776 (+)
G26236 NA other downstream 293067 9068729 ~ 9155343 (+)
cers3a cers3,LOC102798777 other downstream 557567 9333229 ~ 9378611 (+)
adamts17 adamts17 other downstream 615446 9391108 ~ 9604462 (+)
asb7 asb7,LOC102792420 other downstream 877916 9653578 ~ 9677027 (+)
aldh1a3 aldh1a3,LOC106562593,LOC103357544,LOC104941118 other downstream 1039035 9814697 ~ 9860000 (+)

Expression


Co-expression Network