G26984


Basic Information

Item Value
gene id G26984
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053114.1
NCBI id CM020911.1
chromosome length 46923577
location 12638732 ~ 12638986 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU36002
attagcgttagcatgctaatgctaacgctacgagctaacggttgcggttagccagctcatttcggattgtgacgtcacagtccgagccgattttgaacagctcaccaggagactgaaggcaggacacattcagaaaccgtatctcactcaaaacagcatggatggatttttttcaaagtttgtatgtgtgtggaagcaccagagacacaaaagaacaccccaaataccagaaaaagtgtttttttcataatatgg

Function

GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU36002 True 255 lncRNA 0.44 1 12638732 12638986

Neighbor

gene id symbol gene type direction distance location
LOC120555527 NA coding upstream 76179 12556047 ~ 12562553 (+)
LOC120556595 NA coding upstream 607004 12031621 ~ 12031728 (+)
minar1 kiaa1024,LOC107562943,LOC102799073 coding upstream 1500334 10934633 ~ 11138398 (+)
LOC120555826 NA coding upstream 1507260 11129921 ~ 11131472 (+)
shcbp1 shcbp1,LOC104947898,LOC104967817 coding upstream 1798583 10789845 ~ 10840149 (+)
LOC120556313 LOC104939823,LOC100707594,LOC101479997,LOC105924362 coding downstream 426966 13065952 ~ 13071332 (+)
LOC120556474 NA coding downstream 450549 13089535 ~ 13091435 (+)
si:cabz01068815.1 NA coding downstream 505521 13144507 ~ 13176403 (+)
kbtbd13 NA coding downstream 565853 13204839 ~ 13208335 (+)
spg21 spg21,LOC102788283 coding downstream 613179 13252165 ~ 13271218 (+)
G26980 NA non-coding upstream 38445 12599641 ~ 12600287 (+)
G26979 LOC104961098 non-coding upstream 39250 12598949 ~ 12599482 (+)
LOC120556106 NA non-coding upstream 46103 12587166 ~ 12592629 (+)
G26975 NA non-coding upstream 68221 12570231 ~ 12570511 (+)
G26967 NA non-coding upstream 75507 12562808 ~ 12563225 (+)
G26994 NA non-coding downstream 29890 12668876 ~ 12669301 (+)
G26998 NA non-coding downstream 33790 12672776 ~ 12674123 (+)
G27012 NA non-coding downstream 163477 12802463 ~ 12802680 (+)
G27016 NA non-coding downstream 187406 12826392 ~ 12826634 (+)
G27023 NA non-coding downstream 231658 12870644 ~ 12870871 (+)
lto1 oraov1 other upstream 726010 11903272 ~ 11912722 (+)
aldh1a3 aldh1a3,LOC106562593,LOC103357544,LOC104941118 other upstream 2778732 9814697 ~ 9860000 (+)
asb7 asb7,LOC102792420 other upstream 2961705 9653578 ~ 9677027 (+)
adamts17 adamts17 other upstream 3034270 9391108 ~ 9604462 (+)
cers3a cers3,LOC102798777 other upstream 3260121 9333229 ~ 9378611 (+)
G27086 NA other downstream 470771 13109757 ~ 13110339 (+)
LOC120556202 NA other downstream 596249 13235235 ~ 13237819 (+)
slc35c1 slc35c1 other downstream 1032491 13671477 ~ 13676613 (+)
lrrc4cb LOC104946080,LOC107396660,LOC103367510,LOC108234802,LOC101071141 other downstream 1170949 13809935 ~ 13856423 (+)
bbox1 bbox1,LOC102798250 other downstream 2069576 14708562 ~ 14735176 (+)

Expression


Co-expression Network