G30423


Basic Information

Item Value
gene id G30423
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053114.1
NCBI id CM020911.1
chromosome length 46923577
location 27636859 ~ 27637082 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU40447
gcatcctacagctctgggcagcctctctcccacttgacatttctgcaggtgacgtgacgtgacctgcagcggcaccccactccacttgaggagcggtcggctcggtgtctctcaaaatctgacgaaaatcttttaaactgacctttgtcgatctgaaatgaagacagattcagcaactgcatggcctatttctcgcttaaaatgttttcagaaacacgtttcgg

Function

NR:

description
PREDICTED: NACHT, LRR and PYD domains-containing protein 12-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU40447 True 224 lncRNA 0.50 1 27636859 27637082

Neighbor

gene id symbol gene type direction distance location
LOC120556085 got2 coding upstream 752 27626984 ~ 27636107 (+)
LOC120556424 LOC103366279,LOC100707167 coding upstream 16964 27605797 ~ 27619895 (+)
cmtr2 cmtr2 coding upstream 51416 27578102 ~ 27585443 (+)
slc38a8b LOC104927248,LOC103366290 coding upstream 66213 27563404 ~ 27570646 (+)
nrn1lb nrn1l,LOC101167108,LOC107381583,LOC103366277 coding upstream 76478 27555193 ~ 27560381 (+)
slc38a7 slc38a7 coding downstream 1262 27638344 ~ 27649337 (+)
LOC120555868 NA coding downstream 18417 27655499 ~ 27661836 (+)
gas8 NA coding downstream 26920 27664002 ~ 27668639 (+)
LOC120556493 strc,LOC103366292,LOC102778251 coding downstream 33439 27670521 ~ 27671873 (+)
LOC120555864 strc coding downstream 34456 27671538 ~ 27687620 (+)
G30364 NA non-coding upstream 149262 27486804 ~ 27487597 (+)
G30287 ctcf,LOC103374180,LOC104965832,LOC102192328 non-coding upstream 180888 27451338 ~ 27455971 (+)
G30280 NA non-coding upstream 337292 27298829 ~ 27299567 (+)
G30235 cgnl1 non-coding upstream 504951 27130176 ~ 27131908 (+)
G30148 aqp9 non-coding upstream 607305 27016958 ~ 27029554 (+)
G30428 NA non-coding downstream 26118 27663200 ~ 27663466 (+)
G30461 NA non-coding downstream 174046 27811128 ~ 27811547 (+)
G30518 NA non-coding downstream 260595 27897677 ~ 27898381 (+)
LOC120555388 NA non-coding downstream 460651 28097733 ~ 28108311 (+)
G30615 NA non-coding downstream 588102 28225184 ~ 28225447 (+)
G30366 NA other upstream 148068 27487677 ~ 27488791 (+)
ogfod1 ogfod1,LOC102779874 other upstream 150090 27473665 ~ 27486769 (+)
G30295 NA other upstream 169838 27465778 ~ 27467021 (+)
LOC120555924 LOC103398348,LOC104965831,LOC103374185 other upstream 172100 27456416 ~ 27464759 (+)
vrk3 NA other upstream 196445 27426288 ~ 27440414 (+)
LOC120555373 LOC102214634,LOC101478275,LOC102310185,LOC103366289 other downstream 163386 27800468 ~ 27807464 (+)
LOC120555397 LOC100695720,LOC100703698,LOC102797576,LOC101469320,LOC102211850,LOC101061652 other downstream 323838 27960920 ~ 27963055 (+)
mvda mvd other downstream 332816 27969898 ~ 27975301 (+)
G30631 NA other downstream 780275 28417357 ~ 28417812 (+)
cmc2 cmc2,LOC102791261 other downstream 833790 28470872 ~ 28477283 (+)

Expression


Co-expression Network