G30576 (mc1r)


Basic Information

Item Value
gene id G30576
gene name mc1r
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053114.1
NCBI id CM020911.1
chromosome length 46923577
location 28001197 ~ 28001428 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU40632
AGGACACCACGGAGCTGCAGATCATCACGTCAATCACGTTGTCCAGGTGGCGCAGCATACCAGGGTGCATGTCCATCAGGCCGTGGTCGTGGAGGAGCATGAATATGGTTTCCACCACGTTGCTGACACTGACCAGCATGTCGGACACAGCCAGGCAGCAGATGAAGTAGTACATGGGTGAGTGCAGGTTGCGGTTTTTGATGATGGCCAGAACCACCAGGATATTCTCCAC

Function

symbol description
mc1r Predicted to enable melanocyte-stimulating hormone receptor activity. Predicted to be involved in adenylate cyclase-activating G protein-coupled receptor signaling pathway and regulation of metabolic process. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Located in plasma membrane. Is expressed in several structures, including endocrine system; female organism; integument; male organism; and nervous system. Human ortholog(s) of this gene implicated in familial melanoma; major depressive disorder; melanoma; oculocutaneous albinism type II; and pigmentation disease. Orthologous to human MC1R (melanocortin 1 receptor).

NR:

description
melanocortin 1 receptor, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU40632 True 232 lncRNA 0.55 1 28001197 28001428

Neighbor

gene id symbol gene type direction distance location
trnal-uaa_2 NA coding downstream 120984 27880131 ~ 27880213 (-)
LOC120556190 LOC104927843,LOC104965371,LOC100704236 coding downstream 129940 27863663 ~ 27871257 (-)
kif7 kif7 coding downstream 145610 27841587 ~ 27855587 (-)
si:ch211-122f10.4 LOC104945215,LOC102776050,LOC102212265,LOC101480742 coding downstream 346789 27649504 ~ 27654408 (-)
gfod2 gfod2,LOC102778057 coding downstream 454393 27541636 ~ 27546804 (-)
foxf1 foxf1 coding upstream 91630 28093058 ~ 28097147 (-)
irf8 irf8 coding upstream 197682 28199110 ~ 28203878 (-)
dusp22a LOC104927513,LOC103374648 coding upstream 204298 28205726 ~ 28224206 (-)
LOC120555377 LOC101062555,LOC102216107,LOC102302772,LOC101473643 coding upstream 224196 28225624 ~ 28227538 (-)
gse1 gse1 coding upstream 238102 28239530 ~ 28420256 (-)
G30551 LOC102797876,LOC102077336,LOC101469017,LOC102307906,LOC103372225 non-coding downstream 43573 27956247 ~ 27957624 (-)
G30519 NA non-coding downstream 102812 27897943 ~ 27898385 (-)
G30517 NA non-coding downstream 105356 27895529 ~ 27895841 (-)
LOC120556451 NA non-coding downstream 162501 27828047 ~ 27838696 (-)
G30496 NA non-coding downstream 171219 27827418 ~ 27829978 (-)
G30579 NA non-coding upstream 9572 28011000 ~ 28019075 (-)
G30586 NA non-coding upstream 35706 28037134 ~ 28038207 (-)
G30634 NA non-coding upstream 223665 28225093 ~ 28225447 (-)
G30644 NA non-coding upstream 341272 28342700 ~ 28392518 (-)
G30691 NA non-coding upstream 667170 28668598 ~ 28668964 (-)
G30465 furin,LOC102777676 other downstream 229387 27766831 ~ 27771810 (-)
G30422 got2 other downstream 367575 27626893 ~ 27633622 (-)
G30319 NA other downstream 685039 27310171 ~ 27316158 (-)
tcf12 tcf12,LOC103372397 other downstream 748114 27164599 ~ 27253083 (-)
atxn1l atxn1l,LOC102793200 other downstream 1186247 26801793 ~ 26814950 (-)
G30577 mc1r other upstream 212 28001640 ~ 28002470 (-)
dbndd1 dbndd1,LOC103136566 other upstream 45331 28046759 ~ 28073479 (-)
LOC120555801 LOC103366895,LOC102194278,LOC102079963,LOC102301182,LOC101475385,LOC102792507 other upstream 446528 28447956 ~ 28550000 (-)
G30693 NA other upstream 667763 28669191 ~ 28669868 (-)
mafa maf,LOC101477682,LOC100702616,LOC102790406,LOC102298902,LOC104927625,LOC102192535,LOC105919746 other upstream 768573 28770001 ~ 28846965 (-)

Expression


Co-expression Network