G33371 (znf408,LOC104941494)


Basic Information

Item Value
gene id G33371
gene name znf408,LOC104941494
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053114.1
NCBI id CM020911.1
chromosome length 46923577
location 41571002 ~ 41571236 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU44305
CCTTTTCCACAGACAGGGCAGCGATGGGGCCTTTCTCCAGTGTGCAGTCTCTCGTGGGACTTCAGGCTGTGTGGGTCCCTCAGGGATTTCCCACAGAAGCTGCAGAGGAAACCTCCTCCGGTGTGGGAGAACATGTGCCGACGGAGGTCGGGTTTCTGGGAGAAGCTCTGGTCACACTCGGAGCAAGGGAACGGCTTCTCTCCGTTGTGAATTCTCAAATGAGCCTCGAGGTTCC

Function

symbol description
znf408 Predicted to enable metal ion binding activity. Acts upstream of or within retina vasculature development in camera-type eye. Predicted to be located in nucleus. Used to study exudative vitreoretinopathy. Human ortholog(s) of this gene implicated in exudative vitreoretinopathy 6 and retinitis pigmentosa 72. Orthologous to human ZNF408 (zinc finger protein 408).

NR:

description
PREDICTED: zinc finger protein 408-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU44305 True 235 lncRNA 0.58 1 41571002 41571236

Neighbor

gene id symbol gene type direction distance location
ppip5k1a ppip5k1 coding downstream 70595 41453032 ~ 41500407 (-)
tp53bp1 tp53bp1,LOC104941490 coding downstream 178187 41361515 ~ 41392815 (-)
LOC120555591 cdkn2aip,LOC102799175,LOC108249214 coding downstream 225807 41342668 ~ 41345195 (-)
iqgap1 iqgap1 coding downstream 297643 41199741 ~ 41273359 (-)
crtc3 LOC103367860 coding downstream 379305 41146518 ~ 41191697 (-)
cdhr5a LOC104966020,LOC102208740,LOC102306030,LOC102082062,LOC107382057,LOC103155221 coding upstream 109037 41680273 ~ 41701675 (-)
LOC120555595 kiaa0895l,LOC105940675,LOC102205198 coding upstream 275023 41846259 ~ 41865163 (-)
LOC120556217 NA coding upstream 333533 41904769 ~ 41910826 (-)
LOC120556548 LOC104961102,LOC105919414,LOC102215897 coding upstream 428993 42000229 ~ 42017731 (-)
pole3 pole3 coding upstream 471953 42043189 ~ 42050360 (-)
G33369 NA non-coding downstream 4582 41566215 ~ 41566420 (-)
G33368 NA non-coding downstream 5527 41560832 ~ 41565475 (-)
G33347 NA non-coding downstream 125260 41445529 ~ 41445742 (-)
G33196 NA non-coding downstream 633938 40936841 ~ 40937064 (-)
G33168 NA non-coding downstream 645948 40920334 ~ 40925054 (-)
G33383 LOC103462981,LOC106924557,LOC102221671,LOC103155220 non-coding upstream 99164 41670400 ~ 41672862 (-)
G33416 NA non-coding upstream 105741 41676977 ~ 41867839 (-)
G33431 NA non-coding upstream 187209 41758445 ~ 41810063 (-)
G33432 NA non-coding upstream 195930 41767166 ~ 41791971 (-)
G33454 NA non-coding upstream 269087 41840323 ~ 41848807 (-)
LOC120556513 NA other downstream 907345 40661364 ~ 40663657 (-)
G33122 NA other downstream 908381 40648676 ~ 40662621 (-)
LOC120556146 NA other downstream 981338 40564241 ~ 40589664 (-)
LOC120556511 LOC102208128,LOC101468289 other downstream 1428954 40049624 ~ 40142048 (-)
slc6a5 slc6a5 other downstream 2335256 39205275 ~ 39235746 (-)
sirt3 sirt3 other upstream 186391 41757627 ~ 41764896 (-)
G33711 NA other upstream 828055 42399291 ~ 42402136 (-)
G33796 NA other upstream 1413987 42985223 ~ 42990770 (-)
G33847 NA other upstream 1643398 43214634 ~ 43214987 (-)
G33914 NA other upstream 1881476 43452712 ~ 43456847 (-)

Expression


Co-expression Network