G35379


Basic Information

Item Value
gene id G35379
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 2705600 ~ 2706455 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU47312
cctagacctactctatctgtaaagtgtctcgagataactcttgttatgatttgatactataaataaaattgaattgaatagtgtgtggcactatctttgtggggaccggtcattgacataatgcattccctagccccttaccctcaccttaaccatcacaactaaatgcctaaccttaacccttaccctaaccttaaccatcaccactaaatgtctaaccttaacccttaccctaaccttaaccatcacaactaaatgtctaaccttaacccttaccctaaccttaaccatcaccactaaatgtctaaccttaacccttaccctaaccttaaccatcacaactaaatgcctaaccttaacccttaccctcaccttaaccatcaccactaaatgtctaaccttaacccttaccctaaccttaaccatcacaactaaatgtctaaccttaacccttaccctaaccttaaccatcacaactaaatgtctaaccttaacccttaccctaaccttaaccatcacaactaaatgcctaaccttaacccttaccctcaccctaaccataacctaattctatccctaatcctac
>TU47313
cctagacctactctatctgtaaagtgtctcgagataactcttgttatgatttgatactataaataaaattgaattgaatagtgtgtggcactatctttgtggggaccggtcattgacataatgcattccctaaccttaaccatcacaactaaatgtctaaccttaacccttaccctaaccttaaccatcacaactaaatgcctaaccttaacccttaccctaaccttaaccatcacaactaaatgcctaaccttaacccttaccctcaccttaaccatcacaactaaatgcctaaccttaacccttaccctcaccctaaccataacctaattctatccctaatcctac

Function

GO: NA

KEGG:

id description
ko04512 ECM-receptor interaction
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU47312 True 586 lncRNA 0.40 2 2705600 2706455
TU47313 False 348 lncRNA 0.39 2 2705600 2706455

Neighbor

gene id symbol gene type direction distance location
ahcy ahcy coding upstream 739084 1938583 ~ 1966516 (+)
LOC120558247 NA coding upstream 749150 1956316 ~ 1956450 (+)
LOC120558248 NA coding upstream 753116 1952350 ~ 1952484 (+)
LOC120558249 NA coding upstream 758173 1947337 ~ 1947427 (+)
chmp4ba chmp4b,LOC101481733,LOC102786921,LOC102203309,LOC104933698,LOC107093444,LOC108243665 coding upstream 778954 1913110 ~ 1926646 (+)
LOC120558018 NA coding downstream 29404 2735859 ~ 2745280 (+)
LOC120557397 NA coding downstream 103803 2810258 ~ 2818790 (+)
LOC120557395 NA coding downstream 120434 2826889 ~ 2836128 (+)
ccdc51 NA coding downstream 157081 2863536 ~ 2882763 (+)
osgn1 LOC102208111,LOC100711663,LOC103370650,LOC101475239 coding downstream 210341 2916796 ~ 2949567 (+)
G35377 NA non-coding upstream 41499 2628787 ~ 2664101 (+)
G35372 NA non-coding upstream 56814 2536528 ~ 2648786 (+)
G35374 NA non-coding upstream 82860 2621875 ~ 2622740 (+)
G35363 NA non-coding upstream 96084 2577634 ~ 2609516 (+)
G35361 NA non-coding upstream 114252 2481317 ~ 2591348 (+)
G35380 NA non-coding downstream 13619 2720074 ~ 2720701 (+)
G35541 NA non-coding downstream 52749 2759204 ~ 2759496 (+)
G35544 NA non-coding downstream 60352 2766807 ~ 2774590 (+)
G35548 NA non-coding downstream 77497 2783952 ~ 2786339 (+)
G35572 NA non-coding downstream 161472 2867927 ~ 2884120 (+)
G35364 NA other upstream 117438 2583514 ~ 2588162 (+)
G35359 NA other upstream 211009 2487994 ~ 2494591 (+)
LOC120556786 NA other upstream 317626 2385615 ~ 2387974 (+)
asip1 NA other upstream 653457 2024224 ~ 2052143 (+)
G35295 LOC107380983,LOC102290002,LOC108241855,LOC108250349,LOC106456447,LOC101470105,LOC102800009,LOC102214284,LOC101480046,LOC102215411,LOC102307835 other upstream 867945 1811624 ~ 1837655 (+)
G35534 NA other downstream 40765 2747220 ~ 2747772 (+)
G35578 NA other downstream 224469 2930924 ~ 3017125 (+)
G35618 NA other downstream 537776 3244231 ~ 3358820 (+)
epha8 epha8,LOC102791453 other downstream 747145 3453600 ~ 3589612 (+)
G35791 LOC101072424,LOC104921976 other downstream 1242379 3948834 ~ 3950128 (+)

Expression


Co-expression Network