G37305 (dcaf12,LOC102784774)


Basic Information

Item Value
gene id G37305
gene name dcaf12,LOC102784774
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 10453961 ~ 10456420 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU50051
TTGCACTTGGTCCCGCATACCACCTGCCTGTGGTTGAGCCACTGTGAAGCAAACACCTTGTTGAGTCGCCCCAGGGAGAACTCCCTCTCCTTGAGGATGCCGGGGAGCCTGCCAGCCGCAAAACCCTGAAGGCTCCGCTGGAGCCGCAACTCATGCTGCTGTTGAGGTCTGAACTCCCGCCCCCGGAGAGCACATACCACCGAGCGCCGACTGCACCACCACTGCTGGGCGTGACGTGATGAACAAGAAACACGGCTCCGCTTGTGTGGCGCTTGACACCAGCCCAGCTGTTGTTGGTCTTTGGGCTCTCCTGCCTTCCTTTTCCTGCTAACTGTTTTTCTCGCCATAATCTGATACACACAGTTCCCTCACCCACATGGAGGGTAAAAGTGACGCTGGACACTGGATCATATAATGGCGATATGCTATTTTGTTCCTTGGCCCTCGCTGGCAGCGTCCGACGACGAGCAAGGGCGATCACATACGGGAGAGGTTGGTAACAAGCTGGTTATTGCCGCTGACTCACTATCATTACCTCGTCCCCTACGCTCCCAACTAATACTACACTCTGGCCTTCGTTAACTAGCTAGCTGCCAGAGAGTAGCTACACACACTCCGTTTTCCTGACCACTCGCGTCAGCAACGGCGA

Function

symbol description
dcaf12 Predicted to be involved in protein ubiquitination. Predicted to be located in cytoplasm and microtubule organizing center. Predicted to be part of Cul4-RING E3 ubiquitin ligase complex. Orthologous to several human genes including DCAF12 (DDB1 and CUL4 associated factor 12).

NR:

description
PREDICTED: DDB1- and CUL4-associated factor 12

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU50051 True 649 lncRNA 0.56 2 10453961 10456420

Neighbor

gene id symbol gene type direction distance location
ube2r2 ube2r2 coding downstream 11892 10434200 ~ 10442069 (-)
rfesd rfesd coding downstream 29174 10421844 ~ 10424787 (-)
cast NA coding downstream 120578 10294535 ~ 10333383 (-)
wdr1 wdr1,LOC102791765 coding downstream 237829 10204986 ~ 10216132 (-)
slc2a9l2 slc2a9 coding downstream 252210 10101729 ~ 10201751 (-)
nop56 nop56 coding upstream 34896 10491316 ~ 10497248 (-)
LOC120558246 NA coding upstream 35870 10492290 ~ 10492357 (-)
LOC120558250 NA coding upstream 37783 10494203 ~ 10494322 (-)
zgc:64106 LOC104941154,LOC108239814,LOC103386237,LOC103356394 coding upstream 45246 10501666 ~ 10520703 (-)
celf4 celf4 coding upstream 97606 10554026 ~ 10639135 (-)
G37276 NA non-coding downstream 142807 10310109 ~ 10311154 (-)
G37245 NA non-coding downstream 151450 10293098 ~ 10302511 (-)
G37258 NA non-coding downstream 183550 10257259 ~ 10270411 (-)
G37260 ptpra non-coding downstream 201408 10252158 ~ 10252553 (-)
G37165 NA non-coding downstream 393554 10059804 ~ 10060407 (-)
G37321 NA non-coding upstream 32380 10488800 ~ 10490052 (-)
G37361 NA non-coding upstream 95873 10552293 ~ 10553381 (-)
G37364 NA non-coding upstream 204366 10660786 ~ 10661268 (-)
G37418 NA non-coding upstream 510137 10966557 ~ 10974888 (-)
G37424 NA non-coding upstream 568715 11025135 ~ 11147436 (-)
rhobtb3 glrx,rhobtb3,LOC102786935 other downstream 34055 10387917 ~ 10419906 (-)
LOC120556768 LOC104965754,LOC103359409,LOC102210396,LOC101479743,LOC102082439,LOC102300053 other downstream 447788 9998996 ~ 10006173 (-)
G37045 lrig1 other downstream 1058391 9394739 ~ 9395570 (-)
LOC120558079 fam19a1,LOC101482978,LOC107385433,LOC108244096,LOC103386186,LOC106518519,LOC101163164,LOC102209545 other downstream 1420294 8906439 ~ 9033667 (-)
mustn1b mustn1,LOC107385427 other downstream 1831139 8619087 ~ 8622822 (-)
tpgs2 tpgs2 other upstream 76106 10532526 ~ 10536353 (-)
fam219aa fam219a,LOC101484940,LOC100701621 other upstream 475815 10932235 ~ 10943639 (-)
LOC120557925 tmem233 other upstream 526650 10983070 ~ 10988818 (-)
G37432 LOC106915059,LOC106958204,LOC102221633,LOC103464975,LOC100700174,LOC101482873,LOC102210230 other upstream 594879 11051299 ~ 11053085 (-)
LOC120557334 cytl1 other upstream 884338 11340758 ~ 11343153 (-)

Expression


Co-expression Network