G42075



Basic Information


Item Value
gene id G42075
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 27442408 ~ 27446281 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU56594
GGCTGTCCGAGATAGTTCTGAGTCACTGGCCTTGGCTCCTCCACTGCTGCCCTTCACCCACGTGACTTGAGCCCGGGGACCCAGCTGGATCTTCTCATCCATTTGAGGCTTGGAGATCTTTGGGATCTTGGTGGGGTCGATGGTCCTGCTGTTCTTCGTCATGGGCACAGTGTTCCAGGTCTCTTCTCTCTGCATGCGCTGCTGATCTCGCTGATCTCTCTGATCTCGCTGATCTCTCTGATCTCTGGGATCTGGCCGTCTCTTGCTGTCCTTGGAGAGCAGTTGCTGCTGCACTTTTCTCTGCTCCTCCTGCTCTTCAATCTTTGCCTCCTTGTGGATCTGCTCGATGGTTTTCGGGCCCTGGTCAGCTCTCCTGGACACCCAGTTGTGCAATCTCAGGTCTATAATGTCTTGTAACATAAATCGTATCCGGGATGACGTCTTCCTCTCCTTGACGATTTTTTCCATCTGATTGAAAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU56594 True 479 lncRNA 0.53 5 27442408 27446281
Loading

Neighbor


gene id symbol gene type direction distance location
zgc:158258 NA coding upstream 39011 27395736 ~ 27403397 (+)
yod1 NA coding upstream 48441 27388769 ~ 27393967 (+)
pfkfb2b pfkfb2,LOC105939516 coding upstream 64087 27364700 ~ 27378321 (+)
phtf1 phtf1 coding upstream 77799 27348913 ~ 27364609 (+)
LOC120558010 LOC103355483,LOC108231584 coding upstream 94308 27346995 ~ 27348100 (+)
alpl alpl coding downstream 75574 27521855 ~ 27542067 (+)
nmur3 LOC102295936,LOC100702544,LOC102199352,LOC101463611 coding downstream 163830 27610111 ~ 27618161 (+)
LOC120556812 NA coding downstream 429261 27875542 ~ 27876611 (+)
lrrc38b LOC108231699,LOC101063821 coding downstream 434812 27881093 ~ 27900596 (+)
aadacl4 NA coding downstream 514444 27960725 ~ 27964094 (+)
G42074 NA non-coding upstream 69 27440480 ~ 27442339 (+)
G42061 NA non-coding upstream 10024 27419787 ~ 27432384 (+)
G42031 NA non-coding upstream 99558 27342599 ~ 27342850 (+)
G42020 NA non-coding upstream 214798 27225283 ~ 27227610 (+)
LOC120558213 NA non-coding upstream 233075 27194172 ~ 27209333 (+)
G42085 NA non-coding downstream 14240 27460521 ~ 27461759 (+)
G42147 NA non-coding downstream 206840 27653121 ~ 27653448 (+)
G42211 NA non-coding downstream 768467 28214748 ~ 28215179 (+)
G42230 chd5,LOC102784485 non-coding downstream 1114513 28560794 ~ 28561264 (+)
G42249 rpl22,LOC104952292 non-coding downstream 1163936 28610217 ~ 28611502 (+)
anks1ab tcp11,LOC103355682,LOC103134623,LOC101477444,LOC102192099,LOC103464730,LOC107089148,LOC106918244 other upstream 677671 26652851 ~ 26764737 (+)
G41850 rps10,LOC102793608 other upstream 893609 26542507 ~ 26548799 (+)
G41825 NA other upstream 1169093 26268602 ~ 26273315 (+)
LOC120558088 LOC104941431 other upstream 1534670 25904769 ~ 25907738 (+)
LOC120558082 kcna10,LOC104941363 other upstream 1569489 25767092 ~ 25872919 (+)
ephb2b LOC104917933,LOC103376520 other downstream 224682 27670963 ~ 27823260 (+)
G42449 NA other downstream 1794132 29240413 ~ 29242253 (+)
ergic3 ergic3,LOC102788871 other downstream 2663254 30109535 ~ 30135834 (+)
G43045 NA other downstream 5013851 32460132 ~ 32460863 (+)
G43051 LOC102201960 other downstream 5024514 32470795 ~ 32471605 (+)

Expression


G42075 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G42075 Expression in each Bioproject

Bar chart with 6 bars.
G42075 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network