G42230 (chd5,LOC102784485)


Basic Information

Item Value
gene id G42230
gene name chd5,LOC102784485
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 28560794 ~ 28561264 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU56813
CCTGCTCTCATCCATGTCATCCAAAGTGTCTTTGTCTCCATTCAATCGACCCTCCGATGCATCCTCACTCTTCATATCATCTGCAACGGCTGGCTTATTTTCCTTGTCTTCAGTTTTTGCCAGAGGAGAATCCGTATCTCCTTTTTCTGAGGACTTCTCTGTATCTTTGCAGGGCTCCATGTTAGGTGAGGTTTGAGTGGATGATAGCTCTGACAGCTTCAAAGCGGACTCTTTTGGGTTGG

Function

symbol description
chd5 Predicted to enable several functions, including ATP binding activity; DNA helicase activity; and metal ion binding activity. Acts upstream of or within ATP-dependent chromatin remodeling; embryonic viscerocranium morphogenesis; and head development. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in brain; eye; and testis. Orthologous to human CHD5 (chromodomain helicase DNA binding protein 5).

NR:

description
PREDICTED: chromodomain-helicase-DNA-binding protein 5 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU56813 True 242 lncRNA 0.47 3 28560794 28561264

Neighbor

gene id symbol gene type direction distance location
LOC120558056 NA coding upstream 191670 28366910 ~ 28369124 (+)
c4h1orf158 NA coding upstream 594400 27964559 ~ 27966394 (+)
aadacl4 NA coding upstream 596700 27960725 ~ 27964094 (+)
lrrc38b LOC108231699,LOC101063821 coding upstream 660198 27881093 ~ 27900596 (+)
LOC120556812 NA coding upstream 684183 27875542 ~ 27876611 (+)
rnf207a rnf207 coding downstream 51276 28612540 ~ 28640689 (+)
LOC120557435 NA coding downstream 159647 28720911 ~ 28722206 (+)
LOC120557430 LOC104950703 coding downstream 275986 28837250 ~ 28855733 (+)
pnp4a LOC103367714,LOC101478937,LOC106510859 coding downstream 323312 28884576 ~ 28891360 (+)
rem1 rem1 coding downstream 343734 28904998 ~ 28915648 (+)
G42211 NA non-coding upstream 345615 28214748 ~ 28215179 (+)
G42147 NA non-coding upstream 907346 27653121 ~ 27653448 (+)
G42085 NA non-coding upstream 1099035 27460521 ~ 27461759 (+)
G42075 NA non-coding upstream 1114513 27442408 ~ 27446281 (+)
G42074 NA non-coding upstream 1118455 27440480 ~ 27442339 (+)
G42249 rpl22,LOC104952292 non-coding downstream 48953 28610217 ~ 28611502 (+)
LOC120557449 NA non-coding downstream 269344 28830608 ~ 28836904 (+)
G42345 NA non-coding downstream 319580 28880844 ~ 28881314 (+)
G42355 NA non-coding downstream 338563 28899827 ~ 28900125 (+)
G42362 NA non-coding downstream 356371 28917635 ~ 28918195 (+)
ephb2b LOC104917933,LOC103376520 other upstream 737534 27670963 ~ 27823260 (+)
anks1ab tcp11,LOC103355682,LOC103134623,LOC101477444,LOC102192099,LOC103464730,LOC107089148,LOC106918244 other upstream 1796057 26652851 ~ 26764737 (+)
G41850 rps10,LOC102793608 other upstream 2011995 26542507 ~ 26548799 (+)
G41825 NA other upstream 2287479 26268602 ~ 26273315 (+)
LOC120558088 LOC104941431 other upstream 2653056 25904769 ~ 25907738 (+)
G42449 NA other downstream 679149 29240413 ~ 29242253 (+)
ergic3 ergic3,LOC102788871 other downstream 1548271 30109535 ~ 30135834 (+)
G43045 NA other downstream 3898868 32460132 ~ 32460863 (+)
G43051 LOC102201960 other downstream 3909531 32470795 ~ 32471605 (+)
LOC120556790 LOC104958239,LOC105940397,LOC103464819,LOC103150142,LOC106923340 other downstream 4476670 33037934 ~ 33041311 (+)

Expression


Co-expression Network