G42870


Basic Information

Item Value
gene id G42870
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 30809829 ~ 30810064 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU57621
gtttttttcgattgctaaacgacagtgggcacaactggagtcacatgtgcaaaactcaaactacagtctgcactaccaccagtcacctgagctaaacagttcacatcacctgcaaaactcattcaaagcaacacaactcttaacacacgtctcaaacagtatgcacaggcctcactgagataacacacactgtcactcagaacacactgagggtaaaaacactagcatcaaacacc

Function

GO: NA

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU57621 True 236 lncRNA 0.44 1 30809829 30810064

Neighbor

gene id symbol gene type direction distance location
lsm3 lsm3,LOC100705055 coding upstream 124294 30679316 ~ 30685535 (+)
abraa LOC103364886,LOC100691009,LOC101485260 coding upstream 296341 30504694 ~ 30513488 (+)
tomm34 tomm34,LOC102784590 coding upstream 366830 30429007 ~ 30442999 (+)
LOC120557913 NA coding upstream 401984 30389010 ~ 30407845 (+)
LOC120557912 NA coding upstream 431933 30354966 ~ 30377896 (+)
LOC120558103 slc6a6,LOC103364884 coding downstream 11617 30821681 ~ 30873506 (+)
zgc:171566 ggh,LOC108243634,LOC102781709,LOC100692082,LOC107384984 coding downstream 567916 31377980 ~ 31417492 (+)
rspo4 LOC103374720,LOC103367962 coding downstream 1570618 32380682 ~ 32444324 (+)
ripor3 LOC100693168,LOC104944097 coding downstream 1837535 32647599 ~ 32730753 (+)
psmf1 psmf1 coding downstream 2009906 32819970 ~ 32834491 (+)
G42836 NA non-coding upstream 132812 30673827 ~ 30677017 (+)
G42797 NA non-coding upstream 217234 30591943 ~ 30592595 (+)
G42793 rims4 non-coding upstream 281483 30518262 ~ 30528346 (+)
G42792 NA non-coding upstream 317988 30491600 ~ 30491841 (+)
G42777 NA non-coding upstream 359617 30405515 ~ 30450212 (+)
G42899 NA non-coding downstream 82836 30892900 ~ 30893662 (+)
G42918 NA non-coding downstream 136308 30946372 ~ 30953050 (+)
G42949 NA non-coding downstream 574321 31384385 ~ 31384694 (+)
G42951 NA non-coding downstream 592020 31402084 ~ 31402447 (+)
G42953 NA non-coding downstream 608362 31418426 ~ 31419591 (+)
ergic3 ergic3,LOC102788871 other upstream 673995 30109535 ~ 30135834 (+)
G42449 NA other upstream 1567576 29240413 ~ 29242253 (+)
ephb2b LOC104917933,LOC103376520 other upstream 2986569 27670963 ~ 27823260 (+)
anks1ab tcp11,LOC103355682,LOC103134623,LOC101477444,LOC102192099,LOC103464730,LOC107089148,LOC106918244 other upstream 4045092 26652851 ~ 26764737 (+)
G41850 rps10,LOC102793608 other upstream 4261030 26542507 ~ 26548799 (+)
G43045 NA other downstream 1650068 32460132 ~ 32460863 (+)
G43051 LOC102201960 other downstream 1660731 32470795 ~ 32471605 (+)
LOC120556790 LOC104958239,LOC105940397,LOC103464819,LOC103150142,LOC106923340 other downstream 2227870 33037934 ~ 33041311 (+)
G43277 NA other downstream 2377674 33187738 ~ 33212318 (+)
angpt4 LOC103371190,LOC107384963,LOC105920078,LOC106931961 other downstream 2452131 33262195 ~ 33336767 (+)

Expression


Co-expression Network