G43595


Basic Information

Item Value
gene id G43595
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 34395913 ~ 34396336 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU58519
TGGACAGTATAATTTCAAACCAGTCCATAAAAGACAATTTCAAGGGTGCACTGGCACTCTTTAGAACAGAGGCCCTTGGAAGTTACTCAAGAGGGCACAAACAGTCCACAGTTGATTGACAGAGCCCACTAGCGTCATTGGTAAGACCCTATTGAATATGTGATACTCTTTGATCCTCCTAATGGCACGCTCAACATGAATGCGAAGTCTGGCTATGGCTTGTGTCTGTCTCACCTCTTCCTGGCTGAAATGTCCACTTGGGCCTAAAAAGGGCGGGATCACAAGGGAGACATTGATTTCAGTGAGAAGGTCCTTGATGAGAAATCCTTTATCAGCCATGACCTCATCGCCTTTCCTCAAGTAGACACAGGATCCCTGATTCTCTTGTGATCTCCTTGTCAGATATCGAACCTGTATACAGGTC

Function

GO:

id name namespace
GO:0006508 proteolysis biological_process

KEGG:

id description
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU58519 True 424 lncRNA 0.46 1 34395913 34396336

Neighbor

gene id symbol gene type direction distance location
LOC120557093 NA coding upstream 24819 34370229 ~ 34371094 (+)
LOC120557827 NA coding upstream 328571 34047432 ~ 34067342 (+)
znf831 NA coding upstream 355630 34026311 ~ 34040283 (+)
barx1 barx1 coding upstream 630405 33760090 ~ 33765508 (+)
LOC120557830 LOC105888650,LOC105896821,LOC101068541,LOC103395674,LOC106527799 coding upstream 877789 33516838 ~ 33518124 (+)
LOC120557490 NA coding downstream 608606 35004942 ~ 35006128 (+)
ube2v1 LOC103133159,LOC106912622,LOC102222270,LOC103465507,LOC104930303,LOC106519068 coding downstream 767148 35163484 ~ 35199996 (+)
LOC120556883 LOC104930311,LOC103370811,LOC104960357,LOC100711115,LOC101474327 coding downstream 878761 35275097 ~ 35278434 (+)
LOC120556789 LOC104930304,LOC100703713,LOC103370810,LOC102215223 coding downstream 920141 35316477 ~ 35319169 (+)
LOC120557477 LOC103375199,LOC104930306,LOC101473264,LOC108251201 coding downstream 1030025 35426361 ~ 35452319 (+)
LOC120557848 NA non-coding upstream 62011 34331444 ~ 34333902 (+)
LOC120557849 NA non-coding upstream 165981 34223432 ~ 34229932 (+)
G43537 NA non-coding upstream 201587 34194028 ~ 34194326 (+)
G43533 NA non-coding upstream 221107 34174509 ~ 34174806 (+)
LOC120557850 NA non-coding upstream 236903 34158005 ~ 34159010 (+)
G43600 NA non-coding downstream 4039 34400375 ~ 34400808 (+)
G43613 NA non-coding downstream 70530 34466866 ~ 34467348 (+)
G43620 NA non-coding downstream 170975 34567311 ~ 34567621 (+)
G43627 NA non-coding downstream 205870 34602206 ~ 34647158 (+)
G43652 NA non-coding downstream 266021 34662357 ~ 34662849 (+)
LOC120557806 LOC105901862,LOC101061984,LOC103047442 other upstream 1050107 33340284 ~ 33345806 (+)
angpt4 LOC103371190,LOC107384963,LOC105920078,LOC106931961 other upstream 1059146 33262195 ~ 33336767 (+)
G43277 NA other upstream 1183595 33187738 ~ 33212318 (+)
LOC120556790 LOC104958239,LOC105940397,LOC103464819,LOC103150142,LOC106923340 other upstream 1354602 33037934 ~ 33041311 (+)
G43051 LOC102201960 other upstream 1924308 32470795 ~ 32471605 (+)
G43656 NA other downstream 268900 34665236 ~ 34667182 (+)
LOC120556915 NA other downstream 1067436 35463772 ~ 35486235 (+)
G43924 NA other downstream 1267807 35664143 ~ 35666041 (+)
trnac-gca_18 NA other downstream 1566203 35962539 ~ 35962610 (+)
fezf2 fezf2 other downstream 2306919 36703255 ~ 36711295 (+)

Expression


Co-expression Network