G43719


Basic Information

Item Value
gene id G43719
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 34934316 ~ 34938283 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU58694
CCAGCTTGTTGAAGTAGTACATTGCCGCCTCCTCTGCAGACACGTTCCGAGTGTGTAGAAGTGCCTGTTTGGCTGCCTCCTCTGGGATGTCCAGCTCTCTGAGCTGCTGCAGAAAAACAGGGTTGACATCCTGAGAGCCGGAGTCTGGGCCTGACTGCTCTGATGGCTCCATTCTTGACTGTTCTTCTGCGCAAAACGACGCGATTTCTAGAAGTATTAGTTTTCACCTGCGACGGAAAAATTTCTGTGTGAACGGGAAATTACATTAAGTGTAATTCCGACTGCACTGTCTTCAGGGTTAACGTTACTCCATTTTGGACCCTTCTGATTGTTGGCACAGGATGCTGCCTCTTGTCGAGTGTGGTGTTACAGATGTTC

Function

NR:

description
PREDICTED: probable ATP-dependent RNA helicase DDX17

GO:

id name namespace
GO:0022412 cellular process involved in reproduction in multicellular organism biological_process
GO:0019538 protein metabolic process biological_process
GO:0007281 germ cell development biological_process
GO:0006508 proteolysis biological_process
GO:0003006 developmental process involved in reproduction biological_process

KEGG:

id description
ko04080 Neuroactive ligand-receptor interaction
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption
ko05164 Influenza A

RNA

RNA id representative length rna type GC content exon number start site end site
TU58694 True 378 lncRNA 0.49 3 34934316 34938283

Neighbor

gene id symbol gene type direction distance location
LOC120557093 NA coding upstream 563222 34370229 ~ 34371094 (+)
LOC120557827 NA coding upstream 866974 34047432 ~ 34067342 (+)
znf831 NA coding upstream 894033 34026311 ~ 34040283 (+)
barx1 barx1 coding upstream 1168808 33760090 ~ 33765508 (+)
LOC120557830 LOC105888650,LOC105896821,LOC101068541,LOC103395674,LOC106527799 coding upstream 1416192 33516838 ~ 33518124 (+)
LOC120557490 NA coding downstream 66659 35004942 ~ 35006128 (+)
ube2v1 LOC103133159,LOC106912622,LOC102222270,LOC103465507,LOC104930303,LOC106519068 coding downstream 225201 35163484 ~ 35199996 (+)
LOC120556883 LOC104930311,LOC103370811,LOC104960357,LOC100711115,LOC101474327 coding downstream 336814 35275097 ~ 35278434 (+)
LOC120556789 LOC104930304,LOC100703713,LOC103370810,LOC102215223 coding downstream 378194 35316477 ~ 35319169 (+)
LOC120557477 LOC103375199,LOC104930306,LOC101473264,LOC108251201 coding downstream 488078 35426361 ~ 35452319 (+)
G43691 NA non-coding upstream 39542 34857903 ~ 34894774 (+)
G43700 setd5 non-coding upstream 49337 34880724 ~ 34884979 (+)
G43680 setd5 non-coding upstream 72366 34766647 ~ 34861950 (+)
G43687 NA non-coding upstream 108776 34795463 ~ 34825540 (+)
G43652 NA non-coding upstream 271467 34662357 ~ 34662849 (+)
G43722 NA non-coding downstream 112 34938395 ~ 34938594 (+)
G43723 NA non-coding downstream 2908 34941191 ~ 34941440 (+)
G43729 LOC100711384,LOC101475072,LOC102214007,LOC103373511 non-coding downstream 22370 34960653 ~ 34962183 (+)
G43737 NA non-coding downstream 58330 34996613 ~ 34998737 (+)
LOC120557494 NA non-coding downstream 65189 35003472 ~ 35004768 (+)
G43656 NA other upstream 267134 34665236 ~ 34667182 (+)
LOC120557806 LOC105901862,LOC101061984,LOC103047442 other upstream 1588510 33340284 ~ 33345806 (+)
angpt4 LOC103371190,LOC107384963,LOC105920078,LOC106931961 other upstream 1597549 33262195 ~ 33336767 (+)
G43277 NA other upstream 1721998 33187738 ~ 33212318 (+)
LOC120556790 LOC104958239,LOC105940397,LOC103464819,LOC103150142,LOC106923340 other upstream 1893005 33037934 ~ 33041311 (+)
LOC120556915 NA other downstream 525489 35463772 ~ 35486235 (+)
G43924 NA other downstream 725860 35664143 ~ 35666041 (+)
trnac-gca_18 NA other downstream 1024256 35962539 ~ 35962610 (+)
fezf2 fezf2 other downstream 1764972 36703255 ~ 36711295 (+)
plekha6 plekha6 other downstream 3022423 37960706 ~ 38096072 (+)

Expression


Co-expression Network