G45557


Basic Information

Item Value
gene id G45557
gene name NA
gene type unknown
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 43838384 ~ 43838852 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU60992
ctggctctatacacgctaaaagtcctgattatttacatggagtctggtggagatatgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggaaatatgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggagatatgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggagatatgctggctctgtacacgctaaaagtcctgattatttacatggagtctggtggaaatatgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggagatatgctggctctatacacactaaaagtcctgattatttacatggagtctggtggaaatatgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggaaatatgctggctctataca

Function

GO: NA

KEGG:

id description
ko01040 Biosynthesis of unsaturated fatty acids
ko04610 Complement and coagulation cascades
ko05133 Pertussis
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus

RNA

RNA id representative length rna type GC content exon number start site end site
TU60992 True 469 TUCP 0.41 1 43838384 43838852

Neighbor

gene id symbol gene type direction distance location
nicn1 nicn1,LOC103371623 coding upstream 259379 43568609 ~ 43579005 (+)
LOC120558241 NA coding upstream 327925 43510346 ~ 43510459 (+)
LOC120557146 NA coding upstream 395860 43412120 ~ 43442524 (+)
manf manf,LOC102787989 coding upstream 1187053 42645340 ~ 42651331 (+)
LOC120557750 NA coding upstream 1207448 42617221 ~ 42630936 (+)
LOC120558025 LOC102289652,LOC101467503,LOC103368898 coding downstream 56782 43895634 ~ 44107691 (+)
amigo3 NA coding downstream 377561 44216413 ~ 44220156 (+)
LOC120557212 NA coding downstream 511555 44350407 ~ 44352218 (+)
LOC120557215 mkrn2os coding downstream 643973 44482825 ~ 44486761 (+)
LOC120557218 rbm39,LOC106937047,LOC103363772,LOC103131234 coding downstream 661192 44500044 ~ 44510159 (+)
G45550 NA non-coding upstream 69312 43768871 ~ 43769072 (+)
G45540 NA non-coding upstream 136376 43622307 ~ 43702008 (+)
G45543 NA non-coding upstream 194484 43643674 ~ 43643900 (+)
G45539 NA non-coding upstream 222292 43615850 ~ 43616092 (+)
G45538 NA non-coding upstream 224786 43613398 ~ 43613598 (+)
G45562 NA non-coding downstream 52263 43891115 ~ 43939634 (+)
G45576 NA non-coding downstream 114987 43953839 ~ 43954039 (+)
G45579 NA non-coding downstream 124745 43963597 ~ 43963822 (+)
G45580 NA non-coding downstream 148083 43986935 ~ 43987969 (+)
G45582 NA non-coding downstream 157318 43996170 ~ 43996369 (+)
rbm15b rbm15b,LOC102788268 other upstream 1179996 42654788 ~ 42658388 (+)
G45237 NA other upstream 1536489 42278285 ~ 42301895 (+)
map1lc3a map1lc3a,LOC107551126 other upstream 1926267 41905529 ~ 41912117 (+)
dynlrb1 dynlrb1,LOC106565026 other upstream 1935753 41896995 ~ 41902631 (+)
G45186 NA other upstream 1958017 41869730 ~ 41880367 (+)
G45577 NA other downstream 117975 43956827 ~ 43957173 (+)
G45635 NA other downstream 521934 44360786 ~ 44468991 (+)
G45647 NA other downstream 565051 44403903 ~ 44407449 (+)
tsen2 tsen2,LOC102785813 other downstream 650104 44488956 ~ 44499296 (+)
LOC120557302 kcnq2,LOC107384874,LOC103370155,LOC108251245 other downstream 873563 44712415 ~ 44744790 (+)

Expression


Co-expression Network