Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_005102

Basic Information

Item	Value
gene id	XLOC_005102
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007123.7
NCBI id	CM002896.2
chromosome length	49182954
location	4089737 ~ 4129820 (-)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00011073
CCTGGGAGTATGATGAAATGATCCCTCCATCTCGTCCATTGAAGATGTAGATGCTACCCTTTCCATCCTCCTCTAACGGTGCACCAACCAGCACATCCCTATAACCATCACCATTCAGATCTGCTGGACTGGCCAGAGAAGAGCCAAAGCGACCCCTCTGACCGGCCATGCCCACCAGCACCACATCAGAAAAACTGAAG

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00011073	True	200	lncRNA	0.52	2	4089737	4129820

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_005101	aldoab	coding	downstream	19679	4052180 ~ 4070058 (-)
XLOC_005100	si:ch211-180a12.2	coding	downstream	61658	3998764 ~ 4028079 (-)
XLOC_005099	si:ch211-136m16.8	coding	downstream	96898	3981346 ~ 3992839 (-)
XLOC_005098	ppp4cb	coding	downstream	111395	3964351 ~ 3978342 (-)
XLOC_005097	eif3c	coding	downstream	127365	3944229 ~ 3962372 (-)
XLOC_005103	NA	coding	upstream	13774	4143594 ~ 4169699 (-)
XLOC_005104	si:dkey-32n7.7	coding	upstream	41101	4170921 ~ 4185554 (-)
XLOC_005105	NA	coding	upstream	60202	4190022 ~ 4194304 (-)
XLOC_005106	si:dkey-32n7.8	coding	upstream	66673	4196493 ~ 4199728 (-)
XLOC_005107	si:dkey-32n7.9	coding	upstream	72006	4201826 ~ 4206869 (-)
XLOC_005094	NA	non-coding	downstream	224503	3860464 ~ 3865234 (-)
XLOC_005092	NA	non-coding	downstream	303355	3782621 ~ 3786382 (-)
XLOC_005087	NA	non-coding	downstream	519656	3569747 ~ 3570081 (-)
XLOC_005086	NA	non-coding	downstream	545721	3519168 ~ 3544016 (-)
XLOC_005083	NA	non-coding	downstream	804828	3281756 ~ 3284909 (-)
XLOC_005109	NA	non-coding	upstream	102037	4231857 ~ 4232505 (-)
XLOC_005111	NA	non-coding	upstream	145090	4274910 ~ 4287034 (-)
XLOC_005112	CU571308.1	non-coding	upstream	156546	4286366 ~ 4286480 (-)

Expression

Co-expression Network