G56453


Basic Information

Item Value
gene id G56453
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053116.1
NCBI id CM020913.1
chromosome length 44101041
location 37952220 ~ 37953077 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU75634
gctcagactgctggacacacctgactacaggagacactagctcagactgctgaacacacctgactacaggagacactagctcagactgctgaacacacctgactacaggagacactagctcagactgctggacacacctgactacaggagacactagctcagactgctgaacacacctgactacaggagacactagctcagactgctggacacacctgactacaggagacactagctcagactgctgaacacacctgactacaggaaacactagctcagactgctgaacacacctgactacaggagacactagctcagactgctgaacacacctgactacaggagacatcagctcagactgctgaacacacctgactacaggagacactagctcagac
>TU75636
gctcagactgctggacacacctgactacaggagacactagctcagactgctgaacacacctgactacaggagacactagctcagactgctggacacacctgactacaggagacactagctcagactgctgaacacacctgactacaggagacactagctcagactgctggacacacctgactacaggagacactagctcagactgctgaacacacctgactacaggaaacactagctcagactgctgaacacacctgactacaggagacactagctcagactgctgaacacacctgactacaggagacatcagctcagactgctgaacacacctgactacaggagacactagctcagac

Function

GO:

id name namespace
GO:0005507 copper ion binding molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU75634 True 398 lncRNA 0.52 2 37952220 37953077
TU75636 False 359 lncRNA 0.52 2 37952220 37953077

Neighbor

gene id symbol gene type direction distance location
mthfr mthfr coding downstream 622817 37297505 ~ 37329403 (-)
LOC120559612 LOC103363412,LOC108249421,LOC107391357 coding downstream 698179 37220534 ~ 37254041 (-)
tbc1d25 tbc1d25 coding downstream 780016 37156368 ~ 37172204 (-)
LOC120559725 rpl22,LOC102779685,LOC106566811,LOC106572248,LOC100699599,LOC101484027,LOC102785448,LOC103376530,LOC102235575,LOC104936395 coding downstream 890525 37053787 ~ 37061695 (-)
plod1a NA coding downstream 999941 36903077 ~ 36952279 (-)
LOC120559054 NA coding upstream 121340 38074417 ~ 38077028 (-)
LOC120559055 NA coding upstream 126804 38079881 ~ 38082216 (-)
tfe3a NA coding upstream 130745 38083822 ~ 38118628 (-)
fgd1 fgd1,LOC103367265 coding upstream 180145 38133222 ~ 38188792 (-)
LOC120559803 LOC102788279,LOC102300940,LOC107099231,LOC104961425 coding upstream 240183 38193260 ~ 38206091 (-)
G56435 NA non-coding downstream 31021 37917959 ~ 37921199 (-)
G56432 plxnb3 non-coding downstream 65205 37885795 ~ 37887015 (-)
G56431 NA non-coding downstream 69207 37882305 ~ 37883013 (-)
G56428 NA non-coding downstream 72688 37878916 ~ 37879532 (-)
G56421 NA non-coding downstream 83627 37824265 ~ 37868593 (-)
G56468 NA non-coding upstream 73669 38026746 ~ 38056778 (-)
G56469 NA non-coding upstream 77921 38030998 ~ 38054663 (-)
LOC120559231 NA non-coding upstream 100498 38053575 ~ 38054241 (-)
G56475 NA non-coding upstream 106832 38059909 ~ 38063750 (-)
G56479 NA non-coding upstream 112646 38065723 ~ 38068854 (-)
G56436 NA other downstream 11672 37926194 ~ 37940548 (-)
LOC120559227 esd other downstream 51877 37882168 ~ 37900343 (-)
G56376 NA other downstream 112371 37569060 ~ 37839849 (-)
G56335 NA other downstream 578904 37372635 ~ 37373316 (-)
phc2a LOC103367632,LOC102778931,LOC100708466,LOC102197996 other downstream 951069 36984885 ~ 37001151 (-)
LOC120559229 NA other upstream 46925 38000002 ~ 38046669 (-)
G56438 NA other upstream 120262 38073339 ~ 38169676 (-)
G56441 NA other upstream 186967 38140044 ~ 38167270 (-)
G56504 NA other upstream 302586 38255663 ~ 38378423 (-)
G56539 NA other upstream 452183 38405260 ~ 38406187 (-)

Expression


Co-expression Network