G56761


Basic Information

Item Value
gene id G56761
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053116.1
NCBI id CM020913.1
chromosome length 44101041
location 39661001 ~ 39698670 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU76142
ggttagattttttgatcactgtttaggtacattaagctttttccttacaatatcccttaatgaagcagaaacccttaatgtcagctacgtccattgggttagatttttgacagttttcagtggttatgaaagagaaatttggtaatccttgatcattacccgctctagctgagctgggaatctgccgcgcttcgtgattt

Function

GO: NA

KEGG:

id description
ko00830 Retinol metabolism
ko00980 Metabolism of xenobiotics by cytochrome P450
ko00982 Drug metabolism - cytochrome P450
ko05204 Chemical carcinogenesis - DNA adducts

RNA

RNA id representative length rna type GC content exon number start site end site
TU76142 True 200 lncRNA 0.39 2 39661001 39698670

Neighbor

gene id symbol gene type direction distance location
LOC120558856 slc6a8,LOC100704248,LOC102310663 coding downstream 312814 39333262 ~ 39348187 (-)
LOC120558637 syp,LOC103367257,LOC102314167,LOC102203308 coding downstream 1093366 38538673 ~ 38567635 (-)
pcsk1nl NA coding downstream 1129938 38508492 ~ 38531063 (-)
LOC120559059 LOC103370165 coding downstream 1308448 38343487 ~ 38352553 (-)
LOC120559058 NA coding downstream 1324095 38329266 ~ 38336906 (-)
gripap1 gripap1 coding upstream 341315 40039985 ~ 40132853 (-)
LOC120558739 NA coding upstream 552886 40251556 ~ 40254265 (-)
LOC120559070 NA coding upstream 837402 40536072 ~ 40566494 (-)
LOC120559367 NA coding upstream 882001 40580671 ~ 40594368 (-)
LOC120559370 NA coding upstream 900135 40598805 ~ 40602090 (-)
G56752 NA non-coding downstream 17776 39642844 ~ 39643225 (-)
G56746 NA non-coding downstream 44994 39600335 ~ 39616007 (-)
G56725 NA non-coding downstream 56387 39599390 ~ 39604614 (-)
G56727 NA non-coding downstream 56845 39599878 ~ 39604156 (-)
G56724 NA non-coding downstream 89844 39561896 ~ 39571157 (-)
G56769 NA non-coding upstream 25176 39723846 ~ 39816306 (-)
G56784 NA non-coding upstream 152483 39851153 ~ 39859106 (-)
G56785 NA non-coding upstream 156534 39855204 ~ 39863677 (-)
G56809 NA non-coding upstream 327649 40026319 ~ 40026739 (-)
G57007 NA non-coding upstream 368672 40067342 ~ 40194898 (-)
plxna3 plxna3,LOC101485239,LOC102288896 other downstream 32524 39466226 ~ 39628477 (-)
G56721 NA other downstream 46764 39550498 ~ 39614237 (-)
G56718 NA other downstream 147721 39389524 ~ 39513280 (-)
G56599 NA other downstream 418263 39237644 ~ 39242738 (-)
G56598 pim2,LOC105920369,LOC106942189,LOC106931484,LOC104956371 other downstream 458575 39113695 ~ 39202426 (-)
LOC120559369 NA other upstream 962139 40660809 ~ 40669343 (-)
G57041 NA other upstream 1135428 40834098 ~ 40903924 (-)
G57036 NA other upstream 1179212 40877882 ~ 40884606 (-)
G57134 NA other upstream 1313403 41012073 ~ 41110667 (-)
LOC120559188 arl8a,LOC100698319,LOC105027762,LOC103362481 other upstream 1427665 41126335 ~ 41137726 (-)

Expression


Co-expression Network