G57169


Basic Information

Item Value
gene id G57169
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053116.1
NCBI id CM020913.1
chromosome length 44101041
location 41380617 ~ 41381119 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU76802
tttttaattaatacaaagcaaactgagcagaaagaacaagtattttgttggtttgtttctcttcttccaggtgtgactgaagtacccgttgagctgcatcacagctgcactatgtgcatggacctgtgccagtcagcacatcactcacctgtgtgcagaggacaggcagcagtagcacaaaccaagaagggtgcacaaccaggcctgggagagaaaattactgatgtccacaaaaccaaatcagagaaggagcatactatacaaagacaacagtggagagttcctggatcggtctgtcctcaaagtgccagagatctacaag

Function

GO: NA

KEGG:

id description
ko00140 Steroid hormone biosynthesis
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA

RNA id representative length rna type GC content exon number start site end site
TU76802 True 322 lncRNA 0.46 3 41380617 41381119

Neighbor

gene id symbol gene type direction distance location
LOC120559074 NA coding downstream 181483 41165855 ~ 41199134 (-)
itpr3 itpr3 coding downstream 355143 40845208 ~ 41025474 (-)
trnak-uuu_11 NA coding downstream 429022 40951523 ~ 40951595 (-)
trnak-uuu_10 NA coding downstream 432016 40948529 ~ 40948601 (-)
trnak-uuu_9 NA coding downstream 435090 40945455 ~ 40945527 (-)
LOC120558619 NA coding upstream 4190 41385309 ~ 41387846 (-)
LOC120558620 NA coding upstream 32919 41414038 ~ 41414898 (-)
LOC120559078 NA coding upstream 107012 41488131 ~ 41496505 (-)
LOC120558618 NA coding upstream 135866 41516985 ~ 41522289 (-)
LOC120558622 NA coding upstream 167742 41548861 ~ 41561635 (-)
G57155 NA non-coding downstream 200131 41179423 ~ 41180486 (-)
G57149 NA non-coding downstream 221012 41155931 ~ 41159605 (-)
G57031 NA non-coding downstream 254338 41121271 ~ 41126279 (-)
G57034 NA non-coding downstream 267656 41109710 ~ 41112961 (-)
G57144 NA non-coding downstream 308103 41071376 ~ 41072514 (-)
G57199 NA non-coding upstream 160218 41541337 ~ 41541555 (-)
G57265 NA non-coding upstream 193897 41575016 ~ 41578916 (-)
G57271 NA non-coding upstream 240403 41621522 ~ 41773433 (-)
LOC120559836 NA non-coding upstream 376423 41757542 ~ 41758659 (-)
G57533 NA non-coding upstream 712326 42093445 ~ 42093777 (-)
LOC120559188 arl8a,LOC100698319,LOC105027762,LOC103362481 other downstream 242891 41126335 ~ 41137726 (-)
G57146 NA other downstream 249147 41130882 ~ 41131470 (-)
G57134 NA other downstream 269950 41012073 ~ 41110667 (-)
G57041 NA other downstream 476693 40834098 ~ 40903924 (-)
G57036 NA other downstream 496011 40877882 ~ 40884606 (-)
LOC120559079 NA other upstream 335751 41716870 ~ 41731801 (-)
LOC120558546 NA other upstream 523021 41904140 ~ 41918743 (-)
LOC120558559 NA other upstream 747124 42128243 ~ 42134658 (-)
LOC120559080 NA other upstream 792871 42173990 ~ 42188455 (-)
G57595 NA other upstream 1155103 42536222 ~ 42651415 (-)

Expression


Co-expression Network