G58209 (crat,LOC107393635,LOC102215149,LOC101477431)


Basic Information

Item Value
gene id G58209
gene name crat,LOC107393635,LOC102215149,LOC101477431
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053117.1
NCBI id CM020914.1
chromosome length 43979800
location 1053015 ~ 1053413 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU78257
GCCCCCTGCAGCAGCGCCAGCCTCTCTGCGTTCTGTTTAGCTGGGTCTTGCATTGCCTGGACAAATTTGAACGAGTCGACAGTAGTTGCACGGATTGCGTCTGTTCGCCCATATTTGAACATCCGTAACGATGCGCTCTCGTACGTTGAGCAGCACATATTATACATCCTGAAGTAGGCCAGTTGCAGAGCCATTTGCACGAAGGCATCTGGACTCAGC

Function

symbol description
crat Enables acyl-CoA oxidase activity and carnitine O-acetyltransferase activity. Involved in carnitine metabolic process, CoA-linked and fatty acid metabolic process. Located in mitochondrion and peroxisome. Implicated in neurodegeneration with brain iron accumulation.

NR:

description
PREDICTED: carnitine O-acetyltransferase-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU78257 True 219 lncRNA 0.53 3 1053015 1053413

Neighbor

gene id symbol gene type direction distance location
adamts13 adamts13 coding upstream 732 1029257 ~ 1052283 (+)
zbtb34 zbtb34,LOC100694860,LOC102780544,LOC102300203 coding upstream 175198 870031 ~ 877817 (+)
mvb12bb LOC104950954 coding upstream 279802 732697 ~ 773213 (+)
pbx3b pbx3 coding upstream 459210 532813 ~ 593805 (+)
gapvd1 gapvd1,LOC102777314 coding upstream 620386 381172 ~ 432629 (+)
LOC120560446 LOC104936599 coding downstream 52551 1105964 ~ 1127084 (+)
si:dkeyp-14d3.1 tmem132c coding downstream 104057 1157470 ~ 1329623 (+)
glt1d1 glt1d1 coding downstream 318371 1371784 ~ 1396195 (+)
fzd10 fzd10 coding downstream 423675 1477088 ~ 1480626 (+)
piwil1 piwil1,LOC102785531 coding downstream 448177 1501590 ~ 1531972 (+)
G58157 NA non-coding upstream 153509 898893 ~ 899506 (+)
G58156 NA non-coding upstream 160576 892097 ~ 892439 (+)
G58151 NA non-coding upstream 170764 879254 ~ 882251 (+)
G58057 NA non-coding upstream 480483 541890 ~ 572532 (+)
G58024 dtx1,LOC106585516,LOC106579922 non-coding upstream 793318 257568 ~ 259697 (+)
G58215 ier5l,LOC103375736 non-coding downstream 7616 1061029 ~ 1062510 (+)
G58230 asb6 non-coding downstream 26196 1079609 ~ 1083228 (+)
G58237 NA non-coding downstream 59341 1112754 ~ 1113040 (+)
G58255 NA non-coding downstream 277633 1331046 ~ 1331338 (+)
G58256 NA non-coding downstream 278133 1331546 ~ 1331998 (+)
lmx1bb lmx1b,LOC102213269,LOC100696266 other upstream 215154 789405 ~ 837861 (+)
LOC120560799 NA other upstream 840632 210742 ~ 212383 (+)
dock5 dock5 other downstream 1220265 2273678 ~ 2312665 (+)
lman2lb NA other downstream 1824961 2878374 ~ 2883861 (+)
LOC120560521 tjp2 other downstream 2381752 3435165 ~ 3522756 (+)
G59086 NA other downstream 3063866 4117279 ~ 4117631 (+)
G59172 sub1 other downstream 3370728 4424141 ~ 4429981 (+)

Expression


Co-expression Network