G58937 (tjp2,LOC104956084)


Basic Information

Item Value
gene id G58937
gene name tjp2,LOC104956084
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053117.1
NCBI id CM020914.1
chromosome length 43979800
location 3505674 ~ 3505974 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU79196
CAGTGAATAAGTGAGAGCAGGTCTTCCTCAGTTTGACGGCCTGTTCGTACAGTTTGCGGGCACTGCGGTTGGAGTTGGGGGCGATCCTCTGTCTCAGGGCCTTGATGCCGTGCTTGCTGTCGGGGTTGAAGAAGATGACGATGGGGTACCACTGGGTGTAGTTCAGGGTGTCCACTGCCTTGGGTGTCACATCCAGCAGGGCGTGCTTGTCCTGTGTGGTGTGAGGAATGGGGAAGATTGTTAATGCTTTGGATCAGATCACAGTGCAGAGCGTCTCATCGTTCTGCAATGTGTCTCTTTC

Function

symbol description
tjp2 Enables protein domain specific binding activity; protein tyrosine kinase binding activity; and protein-macromolecule adaptor activity. Involved in several processes, including establishment of endothelial intestinal barrier; intestinal absorption; and positive regulation of blood-brain barrier permeability. Located in several cellular components, including bicellular tight junction; cell-cell contact zone; and nucleus. Implicated in autosomal dominant nonsyndromic deafness 51; disease of metabolism; and progressive familial intrahepatic cholestasis 4.

NR:

description
PREDICTED: tight junction protein ZO-2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU79196 True 301 lncRNA 0.54 1 3505674 3505974

Neighbor

gene id symbol gene type direction distance location
LOC120561346 NA coding downstream 150727 3315816 ~ 3354947 (-)
LOC120561352 gcnt4 coding downstream 190471 3311067 ~ 3315203 (-)
LOC120561362 NA coding downstream 212367 3272451 ~ 3293307 (-)
traf2a traf1,LOC106956159,LOC103356465,LOC106930528,LOC103141905,LOC108249884,LOC102784265 coding downstream 293675 3196486 ~ 3211999 (-)
b3galt8 NA coding downstream 457872 3045676 ~ 3047802 (-)
apba1a apba1 coding upstream 49099 3555073 ~ 3603158 (-)
ptar1 ptar1 coding upstream 100421 3606395 ~ 3621480 (-)
pias2 pias2 coding upstream 293058 3799032 ~ 3816820 (-)
ydjc ydjc coding upstream 324372 3830346 ~ 3844040 (-)
ak6 ak6 coding upstream 338668 3844642 ~ 3848510 (-)
G58935 NA non-coding downstream 9078 3496244 ~ 3496596 (-)
G58933 NA non-coding downstream 13117 3490720 ~ 3492557 (-)
G58932 NA non-coding downstream 15444 3489805 ~ 3490230 (-)
G58931 NA non-coding downstream 17124 3487963 ~ 3488550 (-)
G58922 NA non-coding downstream 38552 3435212 ~ 3467122 (-)
G58938 tjp2,LOC104956084 non-coding upstream 1784 3507758 ~ 3508402 (-)
G58939 NA non-coding upstream 7657 3513631 ~ 3514141 (-)
G58940 NA non-coding upstream 15213 3521187 ~ 3522756 (-)
G58942 NA non-coding upstream 16872 3522846 ~ 3523604 (-)
G58943 NA non-coding upstream 18409 3524383 ~ 3524585 (-)
G58920 LOC106099046,LOC107687292,LOC107712180,LOC107663003 other downstream 88820 3415627 ~ 3416854 (-)
G58919 NA other downstream 108178 3397169 ~ 3397496 (-)
si:ch211-102c2.4 NA other downstream 265611 3232606 ~ 3240063 (-)
tnc tnc,LOC104930867,LOC103356464 other downstream 371125 3049669 ~ 3134549 (-)
LOC120561349 donson,LOC102310661 other downstream 659067 2834188 ~ 2846607 (-)
G58994 NA other upstream 182655 3688629 ~ 3689338 (-)
golph3a golph3,LOC103397487,LOC108249570 other upstream 703774 4209748 ~ 4224568 (-)
sub1b sub1 other upstream 918175 4424149 ~ 4430090 (-)
LOC120560375 NA other upstream 926870 4432844 ~ 4436316 (-)
LOC120561493 NA other upstream 1960249 5466223 ~ 5466437 (-)

Expression


Co-expression Network