G59519


Basic Information

Item Value
gene id G59519
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053117.1
NCBI id CM020914.1
chromosome length 43979800
location 6410385 ~ 6411300 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU79957
aagagacttcagatacagtattaggggaccactaaggtctatataaaagagacttcagatacagtattaggggaccactaaggcctataagagacttcagatacagtattaggggaccactaaggtctatattaaagagacttcagatacagtattaggggaccactaaggtctatataaaagagacttcagatacagtattagaggaccactaaggcctatataaaagagacttcagatacagtattaggggaccactaaggcctataagagacttcagatacagtattaggggaccactaaggtctatataaaagatacttcagatacagtattaggggaccactaaggtctatataaaagatacttcagatacagtattaggggaccactaaggtctatataaaagatacttcagatacagtattaggggaccactaaggtctatataaaagatacttcagatacagtattaggggaccactaaggtctatataaaagatacttcagatacagtattaggggaccactaaggtctatataaaagatacttcagatacagtattaggggaccactaaggcctataagatacttcagatacagtattaggggaccactaaggtctatataaaagatacttcagatacagtattaggggaccactaaggtctatataaaagatacttcagatacagtattaggggaccactaaggtctatataaaagatacttcagatacagtattaggggaccactaaggcctatataaaagagacttcagatacagtattaggggaccactaaggtctatataaaagagacttcagatacagtattaggggaccactgaggcctatataaaagagacttcagatacagtattaggggaccactaaggcctatataaaagcatcc

Function

GO:

id name namespace
GO:0051179 localization biological_process
GO:0051234 establishment of localization biological_process
GO:0055085 transmembrane transport biological_process
GO:0030001 metal ion transport biological_process
GO:0006810 transport biological_process
GO:0006811 ion transport biological_process
GO:0006812 cation transport biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU79957 True 916 lncRNA 0.37 1 6410385 6411300

Neighbor

gene id symbol gene type direction distance location
tbx1 tbx1 coding downstream 348523 6048963 ~ 6061862 (-)
tango2 tango2 coding downstream 743176 5643204 ~ 5667209 (-)
dgcr8 dgcr8,LOC102791485 coding downstream 784000 5607031 ~ 5626385 (-)
ranbp1 ranbp1,LOC102791189 coding downstream 815481 5590574 ~ 5594904 (-)
pgam5 pgam5 coding downstream 911489 5488756 ~ 5498896 (-)
hk2 LOC103369118,LOC106531304 coding upstream 483902 6895202 ~ 6941736 (-)
ch25hl3 NA coding upstream 750001 7161301 ~ 7169700 (-)
erlin2 LOC100709255,LOC101468631,LOC102303107,LOC102789125,LOC102208735 coding upstream 771513 7182813 ~ 7212011 (-)
LOC120561006 NA coding upstream 809541 7220841 ~ 7223583 (-)
znf703 znf703,LOC103397455 coding upstream 871116 7282416 ~ 7285425 (-)
G59508 NA non-coding downstream 157973 6252205 ~ 6252412 (-)
G59507 NA non-coding downstream 161507 6248633 ~ 6248878 (-)
G59505 NA non-coding downstream 189535 6220585 ~ 6220850 (-)
G59501 NA non-coding downstream 232415 6177751 ~ 6177970 (-)
G59457 NA non-coding downstream 449235 5958908 ~ 5961150 (-)
G59531 NA non-coding upstream 73490 6484790 ~ 6485023 (-)
G59598 NA non-coding upstream 329360 6740660 ~ 6740910 (-)
G59599 NA non-coding upstream 329743 6741043 ~ 6741332 (-)
G59602 NA non-coding upstream 348212 6759512 ~ 6796670 (-)
G59629 NA non-coding upstream 406883 6818183 ~ 6818468 (-)
LOC120561494 NA other downstream 818575 5589573 ~ 5591810 (-)
LOC120561493 NA other downstream 943948 5466223 ~ 5466437 (-)
LOC120560375 NA other downstream 1974069 4432844 ~ 4436316 (-)
sub1b sub1 other downstream 1980295 4424149 ~ 4430090 (-)
golph3a golph3,LOC103397487,LOC108249570 other downstream 2185817 4209748 ~ 4224568 (-)
G59521 NA other upstream 14906 6426206 ~ 6426811 (-)
G59563 NA other upstream 111459 6522759 ~ 6523674 (-)
G59739 LOC102786375,LOC102210956 other upstream 579903 6991203 ~ 6996856 (-)
G59881 NA other upstream 1172786 7584086 ~ 7584519 (-)
specc1la specc1l other upstream 1316260 7727560 ~ 7766012 (-)

Expression


Co-expression Network