G60822


Basic Information

Item Value
gene id G60822
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053117.1
NCBI id CM020914.1
chromosome length 43979800
location 11603778 ~ 11604436 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU81558
tttgaagattattttttgggcttttccgcctttatttgacaggacagctagttgagaaaggggcgagagagagggggaagacatgcaggaaatcgtcacaagtcagatttgaactctggacctctgcgtcgaggcacaaacctccaagtatatgtgcgcctgctctacccgctcaccaatttgtttcttttgctgcagagattcaatacaaaaaaattattgacccatctcagagtagctttatagaatgtacggtttatgaaaaaaaggagacagaggcagaattgtcctggtactcctcttcctctcccttgtgaaggcatttttcttattttctgtgttcatctacagtatattgttcaaataggtcctcttttactgtactaccatatgatcatgtgattgaaagaacctcaacacctgagtgtgtttcctagaagggaatcagctgtgattgatctataacttcaatcagctgtttctcaataaatgcatgtataaaatgcaggggatatatttgtgtttcaatttacaatatgatcagctgttcactttgactttagcctataagttaggtttagaacatgatgttatctgttctgacatacagtgtgaaagcatttgtaaatttggcagtaaagatccattgttttggtttt

Function

GO:

id name namespace
GO:0008152 metabolic process biological_process
GO:0009072 aromatic amino acid family metabolic process biological_process

KEGG:

id description
ko00630 Glyoxylate and dicarboxylate metabolism
ko00360 Phenylalanine metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
TU81558 True 659 lncRNA 0.38 1 11603778 11604436

Neighbor

gene id symbol gene type direction distance location
LOC120561249 fut7,LOC103353858 coding upstream 27424 11573980 ~ 11576354 (+)
ankrd34bb NA coding upstream 326294 11275018 ~ 11277484 (+)
gtf2h2 LOC100696048,LOC102788170,LOC101466805,LOC102292669,LOC102204724 coding upstream 371891 11218951 ~ 11231887 (+)
oclnb LOC104926565,LOC103397562 coding upstream 397666 11193487 ~ 11206112 (+)
marveld2b LOC104926564,LOC103371582,LOC102788930,LOC102293847,LOC101466532 coding upstream 415567 11173019 ~ 11188211 (+)
stxbp1b LOC103353854,LOC103141940,LOC100712335 coding downstream 124026 11728462 ~ 11790629 (+)
LOC120561470 LOC107749966 coding downstream 233322 11837758 ~ 11848140 (+)
dpp7 dpp7 coding downstream 516989 12121425 ~ 12158698 (+)
LOC120561040 NA coding downstream 869645 12474081 ~ 12501550 (+)
LOC120561039 NA coding downstream 869737 12474173 ~ 12485766 (+)
G60821 NA non-coding upstream 167 11603180 ~ 11603611 (+)
G60780 NA non-coding upstream 59119 11488366 ~ 11544659 (+)
LOC120561253 NA non-coding upstream 75023 11528049 ~ 11528755 (+)
G60730 NA non-coding upstream 369198 11234347 ~ 11234580 (+)
G60722 NA non-coding upstream 379816 11210665 ~ 11223962 (+)
G60864 NA non-coding downstream 191545 11795981 ~ 11796327 (+)
G60876 NA non-coding downstream 264189 11868625 ~ 11873116 (+)
LOC120560076 NA non-coding downstream 269056 11873492 ~ 11876959 (+)
LOC120560077 NA non-coding downstream 272537 11876973 ~ 11880769 (+)
G60891 NA non-coding downstream 293657 11898093 ~ 11898916 (+)
LOC120561144 NA other upstream 851338 10748116 ~ 10752440 (+)
LOC120561142 NA other upstream 856825 10726438 ~ 10746953 (+)
LOC120560959 golga7,LOC104937560,LOC106585131 other upstream 1622724 9926950 ~ 9981054 (+)
ppp3cca LOC104934810,LOC100705072,LOC105915415,LOC101486266,LOC102777092,LOC103366803,LOC102200614,LOC101072650,LOC106932221 other upstream 2548013 9017891 ~ 9055765 (+)
vps37ba vps37b,vps37c,LOC102776795 other upstream 2588875 8991441 ~ 9014903 (+)
G60897 NA other downstream 321747 11926183 ~ 11926601 (+)
G61139 tubb2b,tubb4b,LOC103024866,LOC101061694,LOC105901187 other downstream 1316711 12921147 ~ 12923836 (+)
LOC120560904 crb2,LOC103353841,LOC106959700,LOC106929552 other downstream 1527662 13132098 ~ 13180491 (+)
G61337 LOC100705941,LOC102292089,LOC108234925,LOC106529513,LOC104934772,LOC103365846 other downstream 2503047 14107483 ~ 14109546 (+)
G61338 htr7,LOC104934772,LOC101065316 other downstream 2537006 14141442 ~ 14142050 (+)

Expression


Co-expression Network