G61338 (htr7,LOC104934772,LOC101065316)


Basic Information

Item Value
gene id G61338
gene name htr7,LOC104934772,LOC101065316
gene type unknown
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053117.1
NCBI id CM020914.1
chromosome length 43979800
location 14141442 ~ 14142050 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU82172
CTGATCACGCACAGGGTCATGATGGAGGCAGTGCAGCACATTACATCCATGCCGATGAAGATGTTGCAGAACACCTCTCCAAAAAGCCACTTGCCCCCGGTGAGGTCAGTCACTATTACAAACGGCATCACAACTATGGCCACTGACAGGTCCGCCACTGCGAGAGAGACCAGAAGGTAGTTTGAAGGTTGCCTTAGTTTCTTCACCACGCACACCGCGATCACCACCAGCGTGTTCCCCATGACGGTGACGGCCGTGATGATCGCCAACATCACCCCAATAATAATCTTCTCCGGGCGCCCGAAATCCTGCAGCTGCTCCCCGCATGACTCGTTCCACATGGTTGTGGGACTGACGGTGACCAGGACGTTGTACATGAGCTGCAGAGTGCCATTGATAACTTCGGAAATATCCTCTTTCTTGGTAAAAGTGAGCTCAATTCCCGAAGTATTGAACATCACGACAACGTTTTCTCGGAAGGGGTGCAAGGGACACCTCGCCAGTGCACTCTACGCGCATATTTGGATATGTGTAACTTGCTCTCGACTCCTGTCCAGCGGTTTTAGATCGCGACTGTTGCAGCTGCACCACATCGCAGCTGCCAACAAC

Function

symbol description
htr7 Predicted to enable G protein-coupled serotonin receptor activity and neurotransmitter receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger; chemical synaptic transmission; and regulation of synaptic vesicle exocytosis. Predicted to be located in plasma membrane and trans-Golgi network membrane. Predicted to be active in dendrite. Predicted to be integral component of postsynaptic membrane and integral component of presynaptic membrane. Implicated in alcohol use disorder.

NR:

description
PREDICTED: 5-hydroxytryptamine receptor 7

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU82172 True 609 TUCP 0.53 1 14141442 14142050

Neighbor

gene id symbol gene type direction distance location
atad1a atad1,LOC101479261,LOC100705680,LOC104934768,LOC102292399,LOC106527948 coding upstream 141171 13986231 ~ 14000271 (+)
LOC120559997 NA coding upstream 180285 13945038 ~ 13961157 (+)
LOC120561313 olfml2a coding upstream 238793 13869682 ~ 13902649 (+)
adgrd2 NA coding upstream 495092 13567559 ~ 13646350 (+)
lhx2b lhx2 coding upstream 775232 13349141 ~ 13366210 (+)
piwil2 piwil2 coding downstream 5520 14147570 ~ 14188917 (+)
LOC120560074 NA coding downstream 56705 14198755 ~ 14211704 (+)
LOC120560659 LOC103369208,LOC102291259,LOC102215744,LOC101478239 coding downstream 70189 14212239 ~ 14233388 (+)
idua idua coding downstream 92228 14234278 ~ 14246305 (+)
unc119.1 unc119b coding downstream 235204 14377254 ~ 14383227 (+)
G61332 NA non-coding upstream 80271 14060922 ~ 14061171 (+)
LOC120561318 NA non-coding upstream 236102 13904693 ~ 13905340 (+)
LOC120561317 NA non-coding upstream 236784 13903363 ~ 13904658 (+)
LOC120561319 NA non-coding upstream 316208 13812112 ~ 13825234 (+)
G61259 NA non-coding upstream 454530 13686631 ~ 13686912 (+)
G61376 NA non-coding downstream 120105 14262155 ~ 14262869 (+)
G61389 crybb3,LOC103469711 non-coding downstream 183340 14325390 ~ 14327533 (+)
G61391 NA non-coding downstream 186130 14328180 ~ 14329747 (+)
G61431 rnf10,LOC102784202 non-coding downstream 223182 14365232 ~ 14368488 (+)
G61448 NA non-coding downstream 259181 14401231 ~ 14401881 (+)
G61337 LOC100705941,LOC102292089,LOC108234925,LOC106529513,LOC104934772,LOC103365846 other upstream 31896 14107483 ~ 14109546 (+)
LOC120560904 crb2,LOC103353841,LOC106959700,LOC106929552 other upstream 960951 13132098 ~ 13180491 (+)
G61139 tubb2b,tubb4b,LOC103024866,LOC101061694,LOC105901187 other upstream 1217606 12921147 ~ 12923836 (+)
G60897 NA other upstream 2214841 11926183 ~ 11926601 (+)
LOC120561144 NA other upstream 3389002 10748116 ~ 10752440 (+)
LOC120560400 tmem150a,LOC106585116 other downstream 110206 14252256 ~ 14281771 (+)
G61383 NA other downstream 141367 14283417 ~ 14283871 (+)
G61390 crybb2,LOC108234953,LOC100703162 other downstream 175489 14317539 ~ 14319506 (+)
c6h12orf43 NA other downstream 247421 14389471 ~ 14392583 (+)
LOC120560925 NA other downstream 289280 14431330 ~ 14434597 (+)

Expression


Co-expression Network