LOC120560792 (gnrh1)


Basic Information

Item Value
gene id LOC120560792
gene name gnrh1
gene type coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053117.1
NCBI id CM020914.1
chromosome length 43979800
location 2157612 ~ 2160627 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>XM_039803644.1
AACAAATCACAGGAACCTGCCCGACTTCTACACAGAAGAATGGCTACAAGAACCTTGGCAGTGTGGCTGCTGCTTGTGGCGGCAGAATGGCCGCAGGGCTGCTGTCAGCACTGGTCATATGGACTGAGCCCGGGAGGGAAGAGGGATCTGGACAGCCTTTCAGACACACTGGCCAATCTAGTTGAGGGGTTTCCACACGTGGACACACCCTGCAGTGTTCTGGCTTGTGCAGAGGAATCACCCTTCGTCAAGATGTACCGAGCCAAAGGATTTCTTGCCAGTGTCACAGACAGGGAAAATGGACACAGAACATATAAGAAATGATGATTATTTGATTCTACAATAAATTATTACATTGGCATGTCACTATAAA

Function

symbol description
gnrh1 Predicted to enable gonadotropin hormone-releasing hormone activity and gonadotropin-releasing hormone receptor binding activity. Predicted to be involved in reproduction. Predicted to act upstream of or within several processes, including negative regulation of neuron migration; regulation of ovarian follicle development; and response to ethanol. Predicted to be located in extracellular region. Predicted to be active in extracellular space. Implicated in breast cancer; hypogonadotropic hypogonadism 12 with or without anosmia; and periodontitis.

NR:

description
PREDICTED: progonadoliberin-1 isoform X2

GO:

id name namespace
GO:0007275 multicellular organism development biological_process
GO:0005576 extracellular region cellular_component
GO:0005183 gonadotropin hormone-releasing hormone activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_039803644.1 True 373 mRNA 0.49 4 2157612 2160627

Neighbor

gene id symbol gene type direction distance location
kctd9a kctd9 coding upstream 1023 2140097 ~ 2156589 (+)
ccdc92 ccdc92 coding upstream 103131 2037572 ~ 2054481 (+)
ncor2 ncor2 coding upstream 208897 1804636 ~ 1948715 (+)
ep400 ep400 coding upstream 385939 1736678 ~ 1771673 (+)
ulk1a NA coding upstream 421997 1721805 ~ 1735615 (+)
klhl22 klhl22 coding downstream 32285 2192912 ~ 2203066 (+)
LOC120560154 nefl,LOC102797482,LOC104959585 coding downstream 102282 2262909 ~ 2266743 (+)
LOC120561412 lrrtm4,LOC104959581,LOC103353625,LOC101488074,LOC100703069,LOC102799547 coding downstream 205123 2365750 ~ 2434942 (+)
LOC120560453 NA coding downstream 377327 2537954 ~ 2539133 (+)
anapc5 anapc5,LOC102800026 coding downstream 400122 2560749 ~ 2577050 (+)
G58478 NA non-coding upstream 25338 2131948 ~ 2132274 (+)
G58382 NA non-coding upstream 67819 2074820 ~ 2089793 (+)
G58390 lgi3 non-coding upstream 86129 2067585 ~ 2071483 (+)
G58384 NA non-coding upstream 94610 2062620 ~ 2063002 (+)
G58383 NA non-coding upstream 95043 2062074 ~ 2062569 (+)
G58574 NA non-coding downstream 275757 2436384 ~ 2437472 (+)
G58597 NA non-coding downstream 362812 2523439 ~ 2523638 (+)
G58598 NA non-coding downstream 363014 2523641 ~ 2523934 (+)
G58599 NA non-coding downstream 363580 2524207 ~ 2524567 (+)
G58601 NA non-coding downstream 365425 2526052 ~ 2526270 (+)
lmx1bb lmx1b,LOC102213269,LOC100696266 other upstream 1319751 789405 ~ 837861 (+)
LOC120560799 NA other upstream 1945229 210742 ~ 212383 (+)
dock5 dock5 other downstream 113051 2273678 ~ 2312665 (+)
lman2lb NA other downstream 717747 2878374 ~ 2883861 (+)
LOC120560521 tjp2 other downstream 1274538 3435165 ~ 3522756 (+)
G59086 NA other downstream 1956652 4117279 ~ 4117631 (+)
G59172 sub1 other downstream 2263514 4424141 ~ 4429981 (+)

Expression


Co-expression Network